ID: 1100409393

View in Genome Browser
Species Human (GRCh38)
Location 12:94299965-94299987
Sequence TCCCAACAGCTCTACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100409393_1100409394 -6 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409394 12:94299982-94300004 TTGGGAGACCTAGCAGCATATGG 0: 1
1: 0
2: 1
3: 14
4: 92
1100409393_1100409401 27 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409401 12:94300015-94300037 GAGCTAGGCCAGAGTTGAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
1100409393_1100409396 -4 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409396 12:94299984-94300006 GGGAGACCTAGCAGCATATGGGG 0: 1
1: 0
2: 0
3: 6
4: 111
1100409393_1100409395 -5 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409395 12:94299983-94300005 TGGGAGACCTAGCAGCATATGGG 0: 1
1: 1
2: 1
3: 8
4: 78
1100409393_1100409398 0 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409398 12:94299988-94300010 GACCTAGCAGCATATGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 91
1100409393_1100409400 12 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409400 12:94300000-94300022 TATGGGGGAGGTAATGAGCTAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1100409393_1100409397 -3 Left 1100409393 12:94299965-94299987 CCAGGACAGTAGAGCTGTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1100409397 12:94299985-94300007 GGAGACCTAGCAGCATATGGGGG 0: 1
1: 1
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100409393 Original CRISPR TCCCAACAGCTCTACTGTCC TGG (reversed) Intronic