ID: 1100410113

View in Genome Browser
Species Human (GRCh38)
Location 12:94308351-94308373
Sequence AGTCAGCCTAAAGAATGTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100410113 Original CRISPR AGTCAGCCTAAAGAATGTAA AGG (reversed) Exonic
908691703 1:66787328-66787350 AGACATCATAAAAAATGTAAGGG + Intergenic
908743662 1:67354832-67354854 AATCAGCCTAAATAATGTTGGGG - Intronic
908849994 1:68366198-68366220 AGTCAGCCTAAAGAGGGGCAGGG - Intergenic
909019139 1:70411923-70411945 AGTCAGCTTAAAAAATATTAAGG + Intronic
910785256 1:90990720-90990742 AGTCACCCAAAAGGATGAAAGGG + Intronic
911434961 1:97845127-97845149 AGACAGCCTCAAGCATGGAAAGG + Intronic
911727831 1:101260764-101260786 ATTCTCCCTAAAGAATGTATAGG + Intergenic
916162886 1:161937101-161937123 AAAAAGACTAAAGAATGTAAGGG - Intronic
916703448 1:167322118-167322140 ATTCAGGGTAAAGAATTTAAAGG - Intronic
921629804 1:217419721-217419743 AGTCAGATTAAAGAATGGACCGG + Intergenic
923198777 1:231692216-231692238 AGTCAGAGTAAAGAAAGGAAGGG - Intronic
924664291 1:246054849-246054871 AGTCATCCTAATGAGTGTTAAGG - Intronic
924866850 1:247992115-247992137 ACTCAGCCTACTCAATGTAAAGG + Intronic
1063049714 10:2433755-2433777 AGGCAGCCTAATGTAAGTAACGG - Intergenic
1064290296 10:14027844-14027866 AGTTAGCCTGAAGAATGCACAGG + Intronic
1064615044 10:17144757-17144779 AGACAGCCTAAAGAGAGAAACGG + Intronic
1065774446 10:29106444-29106466 ACAGAGCCCAAAGAATGTAAAGG + Intergenic
1068509795 10:57950840-57950862 AGTCAGTCTAAAGAACTGAAGGG + Intergenic
1068767284 10:60777965-60777987 AGACCGCCTCAAAAATGTAAAGG - Intergenic
1070380432 10:75876195-75876217 AGTCAGCCTGAAGAGTGTCCTGG + Intronic
1071147002 10:82587453-82587475 AGTAAGTTTTAAGAATGTAAAGG + Intronic
1071227553 10:83548235-83548257 AGTGAGATTAAATAATGTAATGG + Intergenic
1073646221 10:105307080-105307102 AGTAAACCCAAAGAATGTATAGG - Intergenic
1073749993 10:106514604-106514626 AGCTAGCCTAAGAAATGTAATGG - Intergenic
1074529344 10:114286414-114286436 AGGCAGCCCAAAGCATGTGATGG + Exonic
1078062526 11:8057134-8057156 AGTCACCCTAAAGAACTGAATGG - Intronic
1088653905 11:111980888-111980910 AGTCAGCTTGAAGAATTTAGAGG + Intronic
1093614644 12:21208394-21208416 AGTTAGCAAAAAGAATGCAATGG - Intronic
1097856326 12:64467296-64467318 AGTAAAACTAAAGAATTTAAGGG - Intronic
1099167992 12:79330084-79330106 AGGCAACCTCAGGAATGTAAAGG + Intronic
1100410113 12:94308351-94308373 AGTCAGCCTAAAGAATGTAAAGG - Exonic
1102803040 12:115753390-115753412 AGGCTGCCAAAAGAATCTAATGG + Intergenic
1108870914 13:54984668-54984690 ATTCAGCCTAAAGCATGAGATGG - Intergenic
1110178766 13:72590262-72590284 AGTCAGCCACAAAAATGGAATGG + Intergenic
1114803940 14:25812175-25812197 AGTGAGCTCAAAGAATGTATAGG + Intergenic
1115594672 14:34897880-34897902 AGAAAGCCAAAAGAATGTATAGG - Intergenic
1115783305 14:36795361-36795383 AGTCAGCCTAAAGAATCATGTGG - Intronic
1115862525 14:37704006-37704028 ACTCAGGCTATAGAATGTCATGG - Intronic
1116010358 14:39344397-39344419 AGTTAGCCTAATGAAAGAAAAGG - Intronic
1119809726 14:77506924-77506946 ACTGACCCTAAAGAATGCAATGG - Exonic
1120305190 14:82760735-82760757 TGTCAGACTAGAGAATGCAAAGG + Intergenic
1120539998 14:85739624-85739646 GGTCAGCCTAAAGTCTGTAGGGG - Intergenic
1122515295 14:102304355-102304377 AGTCATTCTAGAAAATGTAACGG - Intronic
1123217727 14:106827662-106827684 AGGCTCCCTAAAGAAAGTAATGG + Intergenic
1124881130 15:33643895-33643917 AGTGAGCCTAAAGAATGACTTGG - Intronic
1135716595 16:24775278-24775300 AGTGAGCATCAAGAATGGAAAGG + Intronic
1136142688 16:28297666-28297688 AAGCAGGCTAAAGAATGGAAGGG + Intronic
1137435483 16:48451296-48451318 AGACAGCCTGCAGAATGGAAGGG - Intergenic
1138377420 16:56575174-56575196 AGTCAGTCTTCAGAATGAAAAGG - Intergenic
1141292800 16:82735847-82735869 AGCCAGCCAATAGAATCTAATGG + Intronic
1143864718 17:9915823-9915845 TGTCAGTCTAAAGAGTCTAAAGG - Exonic
1144543415 17:16168668-16168690 AATCAACCTAAATAATGTATGGG + Intronic
1148476123 17:47929777-47929799 AGTCCGCCTCAAGCATGTAAAGG + Intergenic
1150993781 17:70292176-70292198 AGGCAGACTAACGAATGCAAAGG + Intergenic
1153993944 18:10423464-10423486 TGTCAGCCTAAAGAAGTTAAGGG + Intergenic
1158249420 18:55470021-55470043 TGTCAGCCTTGAAAATGTAATGG + Intronic
1160161735 18:76478557-76478579 ATTCAGCCTATAAACTGTAAGGG - Intronic
1164485970 19:28656038-28656060 AGTCAGACCAAAGAATAAAAAGG + Intergenic
1164694724 19:30234703-30234725 AAAAAGCCTAAAAAATGTAAAGG - Intronic
929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG + Intronic
930313165 2:49767654-49767676 AGTTGGCCTAAAGACAGTAAGGG + Intergenic
930996006 2:57719187-57719209 AGTCATCTTAATGAATGTGAAGG - Intergenic
932037525 2:68261253-68261275 AGTCATCCTAACAAATGTATGGG - Intergenic
933968891 2:87453948-87453970 AGTCTTCATAAAGAAGGTAAAGG + Intergenic
935749774 2:106221391-106221413 ATTTAGCCTAATGAATGTTAGGG - Intergenic
936121511 2:109749856-109749878 ATTTAGCCTAATGAATGTTAGGG + Intergenic
936223186 2:110621612-110621634 ATTTAGCCTAATGAATGTTAGGG - Intergenic
936324901 2:111496557-111496579 AGTCTTCATAAAGAAGGTAAAGG - Intergenic
940289867 2:152067994-152068016 AGTCAACCTAAACACTGTCAAGG - Intronic
941584333 2:167338011-167338033 AGTCACACAGAAGAATGTAATGG - Intergenic
943930515 2:193845444-193845466 AGTGATCCCAAAGAATGTACTGG - Intergenic
947756991 2:232573609-232573631 AGTCAGCATGAAAATTGTAATGG + Intronic
948705589 2:239790308-239790330 AGTCTCCCTTAAGAATGTAAGGG - Intronic
1169450723 20:5708549-5708571 AGGAAGCCTAAAAAATGTGAAGG + Intergenic
1170040602 20:12035674-12035696 AGTCAGCCTCAGGAGTGAAATGG + Intergenic
1173315152 20:41936552-41936574 TGCCAGGCTAAAGAATGGAAAGG - Intergenic
1173895989 20:46551031-46551053 AGTCAGGCTAAAGACAGGAAGGG - Intergenic
1177696744 21:24583073-24583095 AGTATGCCAAAAGAATCTAATGG + Intergenic
1182239603 22:28904828-28904850 ACTCAGCCTGAAGAAAGTCAAGG - Intronic
949172803 3:1022185-1022207 TGACAACCTACAGAATGTAATGG + Intergenic
951700228 3:25488833-25488855 AGGCAGCCTAATGGATGTAGGGG - Intronic
955124892 3:56101542-56101564 AGTGAGCCTCAGGAAAGTAAAGG + Intronic
955304753 3:57819312-57819334 ATTGTGCCTAAAGAATGAAAAGG + Intronic
956538020 3:70300806-70300828 TGTCAGCCTACAGAATGTAGAGG + Intergenic
956707457 3:72011615-72011637 AGTCAGCCTCAGGATTCTAATGG - Intergenic
956715731 3:72078277-72078299 AGTGAACCAAAAGAAAGTAAGGG + Intergenic
956970605 3:74519307-74519329 AGACATCATAAAGAATTTAAAGG - Intronic
957150015 3:76474995-76475017 CGTCAGCCTAAACAAGGAAAAGG + Intronic
957546066 3:81639027-81639049 AATCAGCCTAACAAATGTAAGGG + Intronic
957785853 3:84881850-84881872 AATCAGCCTTTAGAATTTAAAGG - Intergenic
957927658 3:86835443-86835465 AGGCAGCCAGGAGAATGTAAAGG + Intergenic
958034939 3:88159102-88159124 AATTAGCCTACAGAAAGTAAAGG - Intronic
958947711 3:100382272-100382294 ATTCAGCCCAAAGAGTTTAATGG + Intronic
961186224 3:124917664-124917686 AGGGAGCCCAAAAAATGTAATGG + Intronic
963933645 3:151030162-151030184 AGTCAACCTCAAAAATGTGAGGG + Intergenic
964440897 3:156708040-156708062 AGTCAGTCTAAATTTTGTAATGG + Intergenic
964978058 3:162643499-162643521 AGCCTCCCTAATGAATGTAAAGG + Intergenic
965344940 3:167536935-167536957 ATCCAGCCTGAAGAATGGAAAGG - Exonic
966913489 3:184572086-184572108 AATCAGGCTAATAAATGTAATGG - Intronic
967304575 3:188048184-188048206 GGTCAGGCTAAAGAATATCAGGG + Intergenic
967365123 3:188677746-188677768 ATTCAGCCTAACAAATGTTATGG + Intronic
967785871 3:193494860-193494882 AGTCAGACTAAAGAAAAAAAGGG + Intronic
969141825 4:5081533-5081555 AGAAAGCCTAAAGAATGTATTGG - Intronic
970835636 4:20402531-20402553 ATTCAGCCTAAAGAAATAAAAGG + Intronic
971151697 4:24039538-24039560 AGTCAGCTTATAAAATGCAAAGG + Intergenic
972169328 4:36325879-36325901 AGGCAGCCTAAAGCAGATAAGGG - Intronic
972816492 4:42652228-42652250 AGTCAAGCTCAAGACTGTAATGG + Intronic
977508246 4:97929807-97929829 AGACAGCCTACAGAATGGGAGGG - Intronic
980003993 4:127520104-127520126 AGTCATGTTAAAGAATGCAAAGG + Intergenic
981064570 4:140469327-140469349 ATTCACACTGAAGAATGTAAGGG - Intronic
981275108 4:142890333-142890355 AGTCACCCTAGTGAATGTAAAGG + Intergenic
983543008 4:168932410-168932432 AGAAAGCCTACAGAATGTATGGG + Intronic
983863004 4:172731516-172731538 ATTAAGACTAAAAAATGTAAAGG - Intronic
984963441 4:185120370-185120392 GGTATGTCTAAAGAATGTAAAGG - Intergenic
985916199 5:2920728-2920750 GGTCATCCTGAAGAATGTAGAGG - Intergenic
986927833 5:12779913-12779935 ATTCATACTAAAGAATTTAAGGG + Intergenic
988847776 5:35146434-35146456 AGTGAGTCTCAAAAATGTAAAGG - Intronic
989494157 5:42091702-42091724 AGTCAACCAAAAGAATTAAAGGG - Intergenic
991660603 5:68947001-68947023 TGTCAGCATGAAGAATGTCAAGG + Intergenic
993914287 5:93723269-93723291 GGTCAGTCTTAAGAATTTAAAGG - Intronic
994442427 5:99826659-99826681 AGTAATCTTAAAGAATTTAATGG + Intergenic
994632149 5:102299212-102299234 CTGCAGCATAAAGAATGTAAGGG - Intergenic
994662204 5:102667573-102667595 ACTCAGGCTCAAGAGTGTAAAGG + Intergenic
994967054 5:106686506-106686528 AGGCAATTTAAAGAATGTAATGG - Intergenic
996911573 5:128662011-128662033 AGACAGTATAAAGAATGAAAAGG + Intronic
1001107472 5:168867434-168867456 AGTCAAGCTAAAGAATGTGTTGG + Intronic
1004461746 6:15843028-15843050 AGGCAGCCTGAAGAATAAAAGGG - Intergenic
1005366236 6:25080533-25080555 AGTCATCCTAAAGAGTGACAGGG - Intergenic
1006857773 6:37147554-37147576 AGTCAGACTATTGAATCTAAGGG + Intergenic
1010207939 6:73339608-73339630 AGTCAGCCCAAAGAATTCCAAGG + Intergenic
1010882717 6:81199631-81199653 AGACAGTTTAAAGAATGAAAAGG - Intergenic
1011007574 6:82664179-82664201 AGTAAGTTTTAAGAATGTAACGG - Intergenic
1012635523 6:101534466-101534488 AGTCAGCCCAAATGATCTAAAGG + Intronic
1013528728 6:110999450-110999472 TGACAGCCTACAGAAGGTAAAGG - Intronic
1013735117 6:113217449-113217471 TGTCAGCCTTAGAAATGTAAAGG - Intergenic
1014104893 6:117550611-117550633 AGTCAGCCTAGAAAATAGAAAGG + Intronic
1014183745 6:118411928-118411950 AGTGACAATAAAGAATGTAAGGG - Intergenic
1014291468 6:119563363-119563385 ATTCATTCTAAAGAATGAAAAGG - Intergenic
1015991257 6:138945855-138945877 AGTCTCCCTAAATAATGTAAGGG - Intronic
1017055445 6:150431797-150431819 ACTCAGCCAAAAGTAAGTAAAGG - Intergenic
1018607785 6:165616535-165616557 AGTCAGATTAAACAATGTACAGG + Intronic
1018715077 6:166525808-166525830 AATCATCCTGAAGAATGTCAAGG - Intronic
1020990496 7:15189568-15189590 AGTCAGCCAATAAAATGTTAAGG + Intergenic
1022116121 7:27262268-27262290 AGACATCCTGAAGAATGAAATGG - Intergenic
1024314530 7:48002661-48002683 AGACAACCTACAGAATGGAAGGG - Intronic
1024426824 7:49235332-49235354 AGACAGCCTACAGAATGGGAGGG - Intergenic
1025108254 7:56191046-56191068 AGACAGAATAAGGAATGTAAAGG + Intergenic
1030285897 7:107826435-107826457 ATACAGCCTAAACAATGTAGTGG + Intergenic
1032654362 7:133911505-133911527 AGTCATCCAAATGAATGAAAAGG - Intronic
1032945405 7:136846351-136846373 AGTCAGCCTAAGAAATATCAAGG + Intergenic
1038159964 8:25027184-25027206 AGGCAGCTTAATGAATGTATGGG + Intergenic
1038469363 8:27799835-27799857 AGTCAGGCTAAGGAAGGTATTGG + Intronic
1039356494 8:36822857-36822879 AGTCAGCATAAAGAATGACAAGG - Intronic
1039713934 8:40088201-40088223 ATTTAGCCTACAGAATGTAAGGG + Intergenic
1041790778 8:61694048-61694070 AGTCATCATAAAGAATGGCAAGG - Intronic
1042007443 8:64197413-64197435 AGAGAGCATAAAGAATGAAAAGG + Intergenic
1043692426 8:83171789-83171811 AGTCAGAATCAAGAATATAATGG + Intergenic
1044076037 8:87822749-87822771 AATAAGCCTAAAGAGTGCAAAGG + Intergenic
1044349254 8:91144367-91144389 GGTAAGCCTAAAGAATGTAAAGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1048663749 8:136636827-136636849 AGACAACCTAAAGAATGGGAAGG - Intergenic
1050730720 9:8706319-8706341 AGTCAGACTAAATAAAGGAAAGG - Intronic
1050858352 9:10391383-10391405 GTTGAGCATAAAGAATGTAACGG - Intronic
1051962233 9:22780780-22780802 AATCAGCCAAAAGAAAGAAAGGG - Intergenic
1055855709 9:80685183-80685205 AGACAACCTACAGAATGTGAGGG + Intergenic
1058130768 9:101250416-101250438 AGACAACTTTAAGAATGTAATGG - Intronic
1059644791 9:116254141-116254163 AAACAGCCTAAAAAATGTAGGGG - Intronic
1061346508 9:130030477-130030499 AGTCTGCCTAAAGAAAGAATGGG + Intronic
1186947062 X:14580228-14580250 AGTAAGGGTAAAAAATGTAAAGG + Intronic
1188246877 X:27846774-27846796 AGTCAGTTTAAAAAAAGTAAAGG - Intergenic
1188982007 X:36735004-36735026 AGCCAGCCTAAAGAAGGGTATGG - Intergenic
1190536807 X:51437021-51437043 AGATAGCCTAATGAATTTAAGGG - Intergenic
1191579117 X:62740638-62740660 AAAAAGCCTAAAGAACGTAAGGG + Intergenic
1195006167 X:100687906-100687928 AGTCAGGATAATGAATTTAAAGG - Intronic