ID: 1100412115

View in Genome Browser
Species Human (GRCh38)
Location 12:94330193-94330215
Sequence TAGTAGCATTTGTTGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100412115_1100412121 21 Left 1100412115 12:94330193-94330215 CCTCTCCACAACAAATGCTACTA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1100412121 12:94330237-94330259 AGACAACTCAAATCATTTGTGGG 0: 1
1: 0
2: 0
3: 13
4: 199
1100412115_1100412120 20 Left 1100412115 12:94330193-94330215 CCTCTCCACAACAAATGCTACTA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1100412120 12:94330236-94330258 AAGACAACTCAAATCATTTGTGG 0: 1
1: 0
2: 0
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100412115 Original CRISPR TAGTAGCATTTGTTGTGGAG AGG (reversed) Intronic
907073678 1:51559979-51560001 CAGGAGCATGTGTTGGGGAGTGG - Intergenic
912108569 1:106312155-106312177 TAGTTTCTTTTGTTGTGCAGAGG + Intergenic
918958524 1:191240170-191240192 TAGTAGTATGTGTTGGGGATTGG + Intergenic
923419039 1:233794423-233794445 TAGTTTCATTTGCTGTGCAGAGG - Intergenic
1064731669 10:18337431-18337453 TTGTAGCATTTGTTATGTAATGG + Intronic
1070600322 10:77861786-77861808 TAGGAGGCATTGTTGTGGAGTGG - Intronic
1071049059 10:81423600-81423622 TAGTGGGATTTGTTATGGATTGG + Intergenic
1071725487 10:88194195-88194217 GAGAAGGCTTTGTTGTGGAGGGG + Intergenic
1078142461 11:8702218-8702240 TGGTTGCATTTCTTCTGGAGGGG - Intronic
1079270731 11:18983317-18983339 TAATATAATTTGTTCTGGAGGGG - Intergenic
1080816857 11:35766554-35766576 AAGTAGAATTTGTTTTGGAATGG - Intronic
1083367311 11:62149007-62149029 AAGTAGAATTTGTTGAGGTGGGG + Intronic
1083889836 11:65590232-65590254 TAGTGGCATGTGTTGGGGAAGGG - Intronic
1086445008 11:86862122-86862144 TTGTAGTATCTGTTGGGGAGAGG + Intronic
1086760002 11:90617193-90617215 CATTAGCTTTGGTTGTGGAGGGG + Intergenic
1086961902 11:92986409-92986431 TAGCAGCATGGGTTGGGGAGGGG + Intergenic
1088451216 11:109983157-109983179 TAGTAGAATTTGCTTTGGGGAGG - Intergenic
1089287444 11:117416827-117416849 TAGTAGCATTTCTTCTAGAGAGG + Intergenic
1092390519 12:8073507-8073529 TAGAAGCTTTTTTTTTGGAGGGG + Intergenic
1092856058 12:12674832-12674854 TAGTATAATTAGTTGTAGAGGGG + Intronic
1093771125 12:23020007-23020029 TTGAATCATTTGATGTGGAGAGG + Intergenic
1094726991 12:33130253-33130275 TCATAGCACTTGTTATGGAGGGG + Intergenic
1100412115 12:94330193-94330215 TAGTAGCATTTGTTGTGGAGAGG - Intronic
1101665272 12:106807004-106807026 TAGTACCATTTATTGAGAAGGGG - Intronic
1105780897 13:23704658-23704680 AAGTAGCATTTGCTGGGAAGTGG - Intergenic
1107216875 13:37932085-37932107 TTGTTGCATATGTTGTGTAGTGG + Intergenic
1107485587 13:40824046-40824068 AAGTAGCATTTGTTCTGTGGTGG - Intergenic
1107925776 13:45260429-45260451 TAGAAGCATTAGTTGAGGGGAGG + Intronic
1108671318 13:52692108-52692130 TACTAGCATTTCTTATGGATTGG + Intronic
1114205562 14:20568529-20568551 TAGCAGCATGGGTTGGGGAGGGG - Intergenic
1115813282 14:37133774-37133796 AAGTAGCACTTGTAGTGGAACGG - Intronic
1116273793 14:42805219-42805241 CAGTGGGATTTGTTGTAGAGTGG + Intergenic
1117383929 14:55192558-55192580 TAGTAGTGTTTGTTATTGAGAGG + Intergenic
1117721763 14:58635669-58635691 AAGTGGCATTTGGTGAGGAGGGG + Intronic
1118222576 14:63868955-63868977 TGGAAACATTTGTTTTGGAGTGG - Intronic
1127564570 15:60174298-60174320 TATGTGCATTTGTAGTGGAGTGG - Intergenic
1137075208 16:35953362-35953384 TAGTTTCTTTTGTTGTGCAGAGG + Intergenic
1137930006 16:52578035-52578057 GAGAAGCATTTTTTTTGGAGGGG - Intergenic
1142999338 17:3781948-3781970 TTCTAGCATCTGATGTGGAGAGG - Intronic
1155609287 18:27645619-27645641 TAGTAGCTTTTGTTTTGGGGTGG - Intergenic
1155675410 18:28423413-28423435 TAGTAGAATTTGAAGTTGAGTGG + Intergenic
1156316554 18:35973895-35973917 TAGTAGCAATGGATGTGGTGAGG - Intronic
1159417073 18:68166310-68166332 TACTAGGATTTGTTGGGGAGTGG - Intergenic
927277253 2:21272536-21272558 GAGCAGCATTTGTTATGGAAAGG + Intergenic
927536185 2:23861291-23861313 TAGTAGCCTTTTTTGTGCAATGG - Intronic
929840206 2:45452085-45452107 TTGTAGCATTTATTTGGGAGTGG - Intronic
932139790 2:69265140-69265162 TAGGAGCATTTGTTTTCGATTGG - Intergenic
933392109 2:81683940-81683962 TTGTTGCATTTTTTGTAGAGAGG + Intergenic
934632833 2:95948679-95948701 TTTTACCATTTGTTTTGGAGGGG - Intronic
939628362 2:144506139-144506161 TAGTAGGATTTATTGTAGGGGGG - Intronic
945763020 2:213937939-213937961 TAATAGCATTTGCTGTGGAAAGG - Intronic
945840572 2:214882968-214882990 TTGTTGCAGTTGTTGTGGAATGG - Intergenic
946722430 2:222624131-222624153 GAGAGGCATTTGCTGTGGAGAGG - Intronic
1171041757 20:21770667-21770689 TAGTTTCTTTTGTTGTGCAGAGG + Intergenic
1178356671 21:31914956-31914978 TAGGACCATTTGTCGGGGAGGGG - Intronic
1181794898 22:25300329-25300351 TAGCAGAATTTGTGGTGGGGGGG + Intergenic
949418004 3:3833763-3833785 TGGCAGCATGTGTTGGGGAGGGG + Intronic
951843797 3:27063708-27063730 TAGCAGGATTTGCTATGGAGTGG - Intergenic
952667687 3:35926833-35926855 TAGTGTCTTTTGCTGTGGAGAGG + Intergenic
953020996 3:39113200-39113222 TACTAACATTTGTCTTGGAGCGG - Intronic
954907377 3:54074382-54074404 TACAAGCATTTGCTGTGGAGGGG - Intergenic
955543218 3:60000128-60000150 TAGATGCATTAGTTGTGGATGGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
960899064 3:122536073-122536095 TGATAGCATTTGTTGTTGTGGGG - Intronic
964709753 3:159659038-159659060 TAGGTGCATTTGTTGTGTTGTGG + Intronic
965525094 3:169707850-169707872 TTGTAGCATTTGTGGATGAGGGG - Intergenic
967246522 3:187492187-187492209 CAGCTGCATTTGTGGTGGAGTGG - Intergenic
969282110 4:6177749-6177771 TAGTGGCATTGGGGGTGGAGTGG - Intronic
974458822 4:62162656-62162678 TAGCAGCATGGGTTGGGGAGGGG - Intergenic
974742087 4:66020707-66020729 TAGTTTCACTTGCTGTGGAGAGG - Intergenic
974940078 4:68457077-68457099 TAGTTTCTTTTGTTGTGCAGAGG - Intronic
976701758 4:87977679-87977701 CAGTTTCATCTGTTGTGGAGGGG - Intronic
977190610 4:93995435-93995457 TAGTAGCATTTATTTTGGGATGG + Intergenic
977668327 4:99667076-99667098 TTGTAGCCTTTGTTGGGAAGTGG + Intergenic
977806622 4:101307016-101307038 CAGTAGCATTGGTTCTTGAGAGG - Intronic
977930727 4:102746086-102746108 TGGCAGCATGTGTTGGGGAGGGG + Intronic
981331168 4:143512389-143512411 AACTAGCATTTCTAGTGGAGTGG + Intergenic
982457935 4:155632394-155632416 TAGTAGCATTTCATTTGGAGAGG - Intergenic
983194507 4:164791744-164791766 TACTTGAATTTATTGTGGAGTGG + Intergenic
983741005 4:171134005-171134027 GTGCAGCATTTGTTGGGGAGTGG - Intergenic
985497274 5:216457-216479 TAGAAGCATTTTGTGTGGGGTGG - Intronic
985738306 5:1598499-1598521 TAGAAGCATTTTGTGTGGGGTGG + Intergenic
986504208 5:8431996-8432018 AAGTAACATTTGAGGTGGAGGGG - Intergenic
987732727 5:21798506-21798528 TAAAAGCATTTGTTATGGACTGG + Intronic
991216227 5:64159811-64159833 TAGAAGCATCTGCTGTGGATGGG - Intergenic
991490486 5:67178260-67178282 TTGCAGCATTATTTGTGGAGGGG - Intergenic
994862605 5:105217540-105217562 TAGTAGCAGTGGTGGTGGTGAGG + Intergenic
995483111 5:112612408-112612430 TAGCAGCAGTTTTGGTGGAGAGG + Intergenic
995864810 5:116679692-116679714 TAGTTGCTTTTGCTGTGCAGAGG + Intergenic
996230830 5:121061380-121061402 TAGTAGAAACTGCTGTGGAGTGG + Intergenic
997790644 5:136757048-136757070 TAGTGTCCTTTGTTGTGCAGAGG + Intergenic
1000120838 5:158196514-158196536 TATTAGCTTTTGATGGGGAGGGG + Intergenic
1000175388 5:158747263-158747285 TAGGATCATTTGTTGAGAAGCGG + Intronic
1000433071 5:161174302-161174324 TATTAGCATGAGTTTTGGAGAGG + Intergenic
1002794327 6:458845-458867 TAGTTTCTTTGGTTGTGGAGAGG + Intergenic
1003621371 6:7704181-7704203 TATTAACATTTTTTGAGGAGCGG + Intergenic
1004884745 6:20040712-20040734 TAGGATCAACTGTTGTGGAGAGG + Intergenic
1009331788 6:62431756-62431778 TAGTTTCATTTGCTGTGCAGAGG + Intergenic
1009335242 6:62480217-62480239 TCCTAGCATGTTTTGTGGAGAGG - Intergenic
1011059078 6:83242657-83242679 TAGTAGAGTTTGTTGGGGAAAGG - Intronic
1011412025 6:87075708-87075730 TAATTGCATTTTTTGTAGAGAGG - Intergenic
1011861815 6:91767527-91767549 TCATGGCATTTGTTGGGGAGAGG + Intergenic
1012053036 6:94367930-94367952 TAGTCTCATTTGATGTTGAGTGG + Intergenic
1013187177 6:107769816-107769838 TAGTAGCCTTAGATTTGGAGGGG - Intronic
1013437086 6:110121208-110121230 TAGTTGCTTTTGCTGTGCAGAGG - Intronic
1014929378 6:127316062-127316084 TAGTAGAATGTGTGGTGAAGTGG - Intronic
1020047428 7:5051961-5051983 TTGTATCAATTGTTGGGGAGAGG + Intronic
1020574389 7:9907178-9907200 TTGTATCCTTTGTTGTGCAGAGG + Intergenic
1020680939 7:11235417-11235439 ATGTAGCATATGTTGAGGAGGGG - Intergenic
1023192959 7:37602504-37602526 TAGTAGCATTTACTCTGTAGCGG - Intergenic
1023331170 7:39118425-39118447 TAGTATCTTATGTTGTTGAGGGG - Intronic
1026171099 7:67954630-67954652 AAGTAGCATTTGTGGAAGAGTGG + Intergenic
1028126818 7:87122535-87122557 AAGTAGCATCTGTAGTGTAGTGG - Intergenic
1029920350 7:104255958-104255980 TACTATTATTTGTTCTGGAGTGG - Intergenic
1029984544 7:104910893-104910915 TACAAGCATTTGTTGTCTAGAGG + Intergenic
1031357571 7:120806109-120806131 TGGTAGCATTTTCTTTGGAGAGG + Intronic
1031473380 7:122193319-122193341 TATTACCATTTGTTGTTGAATGG + Intergenic
1033526553 7:142220277-142220299 TACTAGCATTTGTTGGGAAAGGG - Intronic
1033526563 7:142220397-142220419 TAGTAGTATTTGTTGGGAAAGGG - Intronic
1041985851 8:63921903-63921925 TGGCAGCATGTGTTGGGGAGGGG - Intergenic
1045458030 8:102401205-102401227 TAATAGCATTTTTTGGGGATCGG - Intronic
1046676650 8:117116008-117116030 TAGTAGAGATTTTTGTGGAGGGG + Intronic
1047079417 8:121443148-121443170 TACTAGCATTTCTTGGGAAGAGG - Intergenic
1050661225 9:7885075-7885097 TAGTATCTTTTGTTGTACAGAGG - Intronic
1050885215 9:10755932-10755954 TAGTTTCTTTTGTTGTGCAGAGG - Intergenic
1051922440 9:22283826-22283848 TAGCAGCATCTGTTCTGGGGAGG + Intergenic
1052094193 9:24364535-24364557 TAGTTGCCTTTGCTGTGCAGAGG + Intergenic
1052945739 9:34166854-34166876 TAGCAGCATCTGTTCTGGGGAGG + Intergenic
1056768962 9:89463227-89463249 TAGTAGCAGGTGGTTTGGAGAGG - Intronic
1059119638 9:111630717-111630739 TACTGGCATTTAGTGTGGAGAGG + Intergenic
1186157378 X:6739531-6739553 TGCTAGCATTTGTTGGGCAGAGG + Intergenic
1186238788 X:7544138-7544160 TACTAGCATTTGGTGGGGAGAGG + Intergenic
1186808735 X:13166311-13166333 TAGTAACATTTATTGAGGATGGG + Intergenic
1193297458 X:79850112-79850134 TGGTAGCATAGGTTGCGGAGTGG - Intergenic
1193673594 X:84419393-84419415 TGGTAGCATTTCTTGTGGTATGG + Intronic
1194889571 X:99361893-99361915 TAGAAGCATTTTTTGGGGGGAGG + Intergenic
1194964451 X:100271386-100271408 TAGTTTCTTTTGTTGTGCAGAGG - Intergenic
1196578922 X:117357082-117357104 CTGTAGCATTTCTTGTGGATAGG + Intergenic
1197875190 X:131095438-131095460 AGTTAGCATTTGTTATGGAGAGG + Intergenic
1199604228 X:149563793-149563815 TAGTAGAGTTAGTGGTGGAGAGG + Intergenic