ID: 1100413487

View in Genome Browser
Species Human (GRCh38)
Location 12:94346791-94346813
Sequence GTGTTGTGGTGTGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100413485_1100413487 4 Left 1100413485 12:94346764-94346786 CCATACATTTGGTCACAGAAGTT 0: 1
1: 14
2: 125
3: 227
4: 442
Right 1100413487 12:94346791-94346813 GTGTTGTGGTGTGAAAACACAGG 0: 1
1: 0
2: 1
3: 37
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100413487 Original CRISPR GTGTTGTGGTGTGAAAACAC AGG Intronic
903341338 1:22656588-22656610 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
903664812 1:24999790-24999812 GTGTTGTGGTGGGAAGTCAGAGG - Intergenic
905041415 1:34962774-34962796 GTGTTGAGGGGGGAAAAAACTGG + Intergenic
907976591 1:59436780-59436802 GTGTTGTCTTGTCACAACACAGG + Intronic
908655753 1:66386306-66386328 TTGTTTTGGTGTGAAAACAGAGG + Intergenic
910075970 1:83279627-83279649 TTGTTGTGGTGTGAGAGTACAGG - Intergenic
912166046 1:107044249-107044271 GTGTTGTGGTCTGAAAAATGAGG + Intergenic
912667782 1:111598613-111598635 TTGTTGTGGTGTGAAAGCAGAGG - Intronic
912796574 1:112697033-112697055 CTGGTGTAGTGTGAAACCACTGG - Intronic
912820538 1:112864282-112864304 TTGTTGTGGTGTGAGAACAGTGG + Intergenic
913671826 1:121104443-121104465 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914023604 1:143891888-143891910 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914662076 1:149799833-149799855 TTGTTGTAGTGTGAAAGCACAGG - Intronic
916027873 1:160850689-160850711 TTGTTGTGGTGTGAAACCAGAGG - Intronic
916392295 1:164343596-164343618 CTGACGTGCTGTGAAAACACTGG + Intergenic
918272295 1:182913485-182913507 TTGTTTTGTTGTGAAAACAGAGG + Intronic
920242272 1:204562039-204562061 GTCTTGAGGTGAGAAAACAGTGG + Intergenic
920844419 1:209581943-209581965 GTGTGGTGGTATTAAAACATGGG - Intergenic
922924044 1:229332446-229332468 TTGTTGTTGTGTGACAACAGAGG + Intronic
923726835 1:236513258-236513280 GTATTATGCTGTGTAAACACAGG - Intergenic
923804413 1:237243090-237243112 GTGTGGTGGTGTGACAGCAGGGG - Intronic
924654842 1:245964361-245964383 GTGATGTGGTGGTAAATCACTGG - Intronic
1064068238 10:12202372-12202394 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1066051246 10:31637792-31637814 CTGTTGTGGGGTGGAGACACGGG - Intergenic
1066122264 10:32300814-32300836 GTGGTGTGTCGTGAAGACACAGG - Intronic
1067315867 10:45161429-45161451 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1067564725 10:47328400-47328422 GTGATGTGGTGTGTGCACACTGG + Intergenic
1067564799 10:47328949-47328971 GTGATGTGGTGTGTGCACACTGG + Intergenic
1067564861 10:47329325-47329347 GTGATGTGGTGTGTGCACACTGG + Intergenic
1067564904 10:47329607-47329629 GTGATGTGGTGTGTGCACACTGG + Intergenic
1067564912 10:47329667-47329689 GTGATGTGGTGTGTGCACACTGG + Intergenic
1069077980 10:64058214-64058236 TAGTTGTGGTATGTAAACACTGG - Intergenic
1069085607 10:64136284-64136306 GTGTTATGGTTTGAAAAACCTGG - Intergenic
1076582688 10:131523303-131523325 GTGTTGTGGTAGGAAAACAGTGG + Intergenic
1077235954 11:1482090-1482112 GTGCTGTGCTGTGAGAGCACAGG - Intronic
1078872178 11:15357841-15357863 GTGATGAGGTGTGAAAACAGAGG + Intergenic
1079902295 11:26202509-26202531 ATGATGTGTTGTGGAAACACAGG + Intergenic
1079925894 11:26490658-26490680 GTGGTTAGGTGTGAAATCACAGG - Intronic
1083039979 11:59676329-59676351 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1084490083 11:69473500-69473522 GTGTGGAGGTGTGAGACCACAGG - Intergenic
1087113728 11:94500302-94500324 GTGTTGAGGTCTGAAAACAAGGG - Intergenic
1090779301 11:129992883-129992905 GTGTTGTGTTCTGAACACACAGG - Intronic
1091977568 12:4837636-4837658 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1092059482 12:5536794-5536816 TTGTTGTGATGTGAGAACAGAGG + Intronic
1093703271 12:22246617-22246639 GTGTTGTAGTGTGAGAACAGAGG + Intronic
1094443686 12:30507169-30507191 TTGTTGTGGTGTGAAAGCAAAGG - Intergenic
1094845279 12:34358793-34358815 TTGTTTTCGTTTGAAAACACAGG + Intergenic
1095257692 12:40059411-40059433 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1095579774 12:43784225-43784247 TTGTTGTGGTGTGAGAGCAAAGG - Intronic
1095730996 12:45506574-45506596 TTGTTGTGGTGTGAGATCAGAGG + Intergenic
1097875058 12:64635665-64635687 GTGGTCTGGTGTGAGAGCACAGG + Intronic
1098387628 12:69935600-69935622 GTATTGTGCTCTGAAAAGACAGG + Intronic
1099723969 12:86400199-86400221 TGGTTGTGGTGTGAGAACAGAGG + Intronic
1100023187 12:90096478-90096500 GTGAAGTGGTGTGAAAACAGGGG - Intergenic
1100413487 12:94346791-94346813 GTGTTGTGGTGTGAAAACACAGG + Intronic
1100963828 12:99991233-99991255 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1101297962 12:103445300-103445322 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1109041189 13:57339033-57339055 TTGTTGTGGTGTGAGAGCAAAGG + Intergenic
1109688308 13:65849726-65849748 ATGTGGTGGAGGGAAAACACAGG - Intergenic
1110536045 13:76652024-76652046 GTGCTGTGGTCTGAGAATACGGG + Intergenic
1111634179 13:90881968-90881990 GTGTGGAGGTGTGGAAACAGAGG + Intergenic
1115567668 14:34638679-34638701 TTGTGGTGGTGTGAGAACAGAGG - Intergenic
1118091346 14:62483370-62483392 GTGTTGTCATGTTAAAACGCAGG - Intergenic
1118830379 14:69426043-69426065 TTGTTGTGGTGTGAGAGCACAGG - Intronic
1119329541 14:73783901-73783923 GGGTTGTGATGTCAAAACACTGG + Intronic
1120247801 14:82026953-82026975 GTGTTGTGGAGGGAACTCACTGG - Intergenic
1122119668 14:99545396-99545418 GAGTTTTGGTTTGAGAACACTGG - Intronic
1122959768 14:105089160-105089182 GTGTGGTGTTGTGTAAACAGTGG + Intergenic
1123074315 14:105659903-105659925 GTGATGTGGTGTGACATCCCTGG - Intergenic
1123074338 14:105660092-105660114 GTGATGGGGTGTGACAACTCTGG - Intergenic
1124391527 15:29262980-29263002 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1125409833 15:39394376-39394398 GTGTTGTGGAGTGATAACATAGG - Intergenic
1126782225 15:52148705-52148727 GTGTTTTTGTGGGGAAACACAGG + Intronic
1127520999 15:59742864-59742886 GTGTCGTGGTATGATAATACAGG + Intergenic
1128581642 15:68814553-68814575 GTGGTGTGCTGTCATAACACAGG + Intronic
1130610154 15:85353942-85353964 GTGTTGTGTTGTGTGAGCACAGG + Intergenic
1131432913 15:92400982-92401004 GTGTTTTTATTTGAAAACACTGG + Intronic
1132366501 15:101261608-101261630 TTGTTATGGTGTGAAAGCAGAGG - Intergenic
1132508468 16:324592-324614 GTGTGGTCTTGTGATAACACTGG - Intronic
1133256415 16:4519217-4519239 TTGTTATGGTGTGAAAGCAGAGG - Intronic
1135610479 16:23862122-23862144 GTGTTGTGCTGTGGAGACTCTGG + Intronic
1137385533 16:48039144-48039166 GTGTTGTGTTGTGGAGACAGTGG + Intergenic
1139556345 16:67713279-67713301 TTATTGTGGTGTGAAAGCAGAGG - Intronic
1140536680 16:75716137-75716159 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1145046592 17:19622429-19622451 GTATTGTTATATGAAAACACTGG + Intergenic
1145099783 17:20065132-20065154 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1146265299 17:31448956-31448978 GTGTTGTGGTGAGAATGCAATGG + Intronic
1148872429 17:50666569-50666591 GTGTTCTGATGGGAAATCACAGG - Intronic
1149485174 17:57036951-57036973 GGATTGTGATGTGAACACACAGG - Intergenic
1149835976 17:59912967-59912989 GTGTGGTGGTATGAAAAGAAGGG - Intronic
1153353324 18:4106655-4106677 GTGTTTTGGTCTGAGAAGACAGG - Intronic
1153415071 18:4837551-4837573 CTGTTGTGGTGTGAGAACAGAGG - Intergenic
1153920716 18:9786676-9786698 TGGTTGTGGTGTGAGAACAGAGG + Intronic
1156930621 18:42638368-42638390 ATGTTGTGGGGTGTAAACTCAGG - Intergenic
1157089610 18:44621716-44621738 GTTTTTTGGTGTGAAAACACTGG - Intergenic
1157409713 18:47453652-47453674 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1157807300 18:50667738-50667760 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1158099261 18:53811201-53811223 TTGTTATGGAGTGAAAACAGAGG - Intergenic
1164949301 19:32322975-32322997 GTGCTGTGGTGTGCAGACATTGG - Intergenic
1165455280 19:35907278-35907300 GTGTTGTGGGGTGCAGAGACAGG + Intronic
1166435576 19:42764320-42764342 ATGTATTGGTGTGAAAACATGGG + Intronic
1166445448 19:42854353-42854375 GTGTATTGGTGTGAAAACATGGG + Intronic
1166448441 19:42878317-42878339 ATGTATTGGTGTGAAAACATGGG + Intronic
1167488573 19:49778186-49778208 TTGTTGTGGTGTGAACATCCTGG + Intronic
1167683262 19:50939075-50939097 GTGGTGTGGTGTGAAAATAGGGG - Intergenic
1168451133 19:56467405-56467427 TTGTTGTGGTGTGACAGCAGAGG - Intronic
1168701213 19:58440654-58440676 GTGTTGTGGGGGGCGAACACTGG - Intergenic
925194091 2:1909465-1909487 GTGATGTTGTGTGAAAAGGCAGG + Intronic
926641032 2:15237302-15237324 GTGATGAGGTTTGAAAACGCAGG - Intronic
928215936 2:29361509-29361531 GCGTTATAGTGGGAAAACACTGG + Intronic
928914507 2:36456880-36456902 GTGTGGTGGGGAGAAAACAACGG - Intronic
929080657 2:38119083-38119105 GTGTTGTGCTGAGGACACACTGG - Intergenic
929880677 2:45834632-45834654 GTGTTGCTGTGTGAATACAATGG - Intronic
930800032 2:55434219-55434241 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
931364270 2:61605344-61605366 GTACTGTAGTGTGAAAACTCTGG + Intergenic
932632201 2:73354704-73354726 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
934106065 2:88695490-88695512 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
934608642 2:95717896-95717918 GTGTGGTGATGAGAGAACACTGG + Intergenic
934912436 2:98271970-98271992 CTGTTGTGGTGCGAGAGCACCGG - Intronic
935247240 2:101229558-101229580 GGGACATGGTGTGAAAACACAGG - Intronic
935985209 2:108665974-108665996 TTGTTGTGGTGTGCAAGCAGAGG - Intronic
936137644 2:109909618-109909640 TTGTTGTGGTGTGCAAGCAGAGG - Intergenic
936207053 2:110461867-110461889 TTGTTGTGGTGTGCAAGCAGAGG + Intronic
938656528 2:133440387-133440409 CTGTTGTTGAATGAAAACACTGG + Intronic
939109502 2:137990758-137990780 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
939394694 2:141613408-141613430 ATGTGGCGGTGTGAAAATACAGG - Intronic
939456166 2:142438745-142438767 GTGTTGGGGTGTGAGAAATCAGG + Intergenic
939944653 2:148395313-148395335 GGGTAGTGGTGTAAAAACAAAGG - Intronic
940548845 2:155125818-155125840 GTGGTGTGGTGGGAAATGACAGG - Intergenic
942563667 2:177246050-177246072 CTGTTGTGGTGTGAACACCAAGG - Intronic
943553254 2:189367506-189367528 GTGTTGTGCTTTGACAGCACTGG - Intergenic
943886818 2:193228650-193228672 TTGTTGTGGTGTGACAGCAGAGG + Intergenic
946155732 2:217805406-217805428 GTGTGGTGGTTTGTACACACAGG - Intronic
946627093 2:221624797-221624819 GTGTTCTGGCAGGAAAACACAGG - Intergenic
946774998 2:223128141-223128163 GTTTATTGGTGAGAAAACACAGG + Intronic
947940668 2:234052198-234052220 ATGTTGTGGTGTGGAGGCACTGG + Intronic
1172354809 20:34272270-34272292 TTGTGGTGGTGTGAAAGCAGAGG - Intergenic
1173384250 20:42573472-42573494 GTGTTGTGGTGAGAATAAGCTGG + Intronic
1175299457 20:57932649-57932671 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1178683168 21:34690250-34690272 GTGCTGTGGGGTGACAGCACTGG - Intronic
1180153810 21:45967321-45967343 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1185016716 22:48347509-48347531 GGCATGTGGTGTGCAAACACAGG + Intergenic
1185169494 22:49284439-49284461 GTGCTGTGATGTGGAAGCACTGG + Intergenic
949252193 3:1998954-1998976 GTGTTGTGTTGTGACATCATAGG + Intergenic
949312288 3:2713321-2713343 TTGCTGTGGTGTGAAAGCAGAGG + Intronic
951499475 3:23367958-23367980 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
951655450 3:25002211-25002233 GTGGTAAGGTGTGAAGACACAGG + Intergenic
951909586 3:27735970-27735992 ATGATGTGGTTTGAAAGCACTGG - Intergenic
952291303 3:32018808-32018830 GTGTTTTTGTGTGATCACACTGG + Intronic
952302021 3:32111706-32111728 GTGGGGTGATGTGAAAACAAGGG - Intronic
953222085 3:40980691-40980713 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
953797905 3:45999684-45999706 TTGTTGTGGTGTGAGAACAGAGG - Intergenic
954812956 3:53259218-53259240 TTGTTGTGGTGTGAGAACAGAGG + Intergenic
955093934 3:55778336-55778358 GTGGTGTGGTAAGAAAACAGAGG + Intronic
956056468 3:65303852-65303874 GTGATGTGGAGTGAAGGCACTGG - Intergenic
958680340 3:97321967-97321989 GAGGTGTGGTGTGACTACACAGG + Intronic
960721342 3:120627352-120627374 GTCTCCTGGTGTGAAAAGACAGG - Intergenic
962326658 3:134440247-134440269 GTGGTGTGGTGTGAGAGCAGAGG - Intergenic
962751441 3:138437073-138437095 GGGTTGTGGGGTGAAAACCTAGG - Intronic
964809811 3:160651506-160651528 GTTTTGTGAATTGAAAACACAGG - Intergenic
965082545 3:164053538-164053560 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
967195519 3:187022297-187022319 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
967911020 3:194542543-194542565 TTGTTGTGGTGTGAGAGCAAAGG + Intergenic
968048773 3:195639396-195639418 GAGGTGTGGTGGAAAAACACAGG - Intergenic
968098629 3:195950228-195950250 GAGGTGTGGTGGAAAAACACAGG + Intergenic
968217426 3:196905253-196905275 CTGTTGTGGTGTGACAGCAAAGG - Intronic
968305845 3:197650528-197650550 GAGGTGTGGTGGAAAAACACAGG + Intergenic
968961699 4:3748752-3748774 GTGAAGTGGTGTGCACACACGGG - Intergenic
972766911 4:42159715-42159737 GTGTTGTGGTGTGAGAGCAGAGG - Intergenic
972811304 4:42589108-42589130 CTGTGGTGGTGTGATAAAACTGG - Intronic
973273884 4:48288652-48288674 GTTTTGTGGTGTGAGAACAGAGG + Intergenic
975162457 4:71139414-71139436 GGGTTCTAGTGTGAAAACAGGGG - Intergenic
975728008 4:77311058-77311080 GTCCTGTGCTGGGAAAACACGGG + Intronic
976685054 4:87804270-87804292 GTGTTTTGGGGTGACAACATGGG - Intronic
977090160 4:92663083-92663105 GTGTAGTGGCCTGAAGACACAGG - Intronic
977528086 4:98168036-98168058 TTGTTGTAGTGTGAAAGCAGAGG + Intergenic
977608143 4:99003721-99003743 CTGTTGTGGTATGAGAACAGAGG - Intronic
977676937 4:99758330-99758352 CTGTTGTGCTGTGAAAGCAGAGG - Intergenic
977718423 4:100209886-100209908 ATGTTGTGGTGTGACAGCAAAGG + Intergenic
977914421 4:102575565-102575587 TTGTTGTGTTTTGAAAACACCGG + Intronic
978425120 4:108573931-108573953 GTGGTGTGGTGGGAAACCAAAGG - Intergenic
978574234 4:110172272-110172294 GGGTAGTGGTGTGAGAACAGAGG + Intronic
979899313 4:126198121-126198143 GGCTTGTGGTGGTAAAACACAGG - Intergenic
980524549 4:133972414-133972436 GTCTTGGAGTGTGAAAACAGGGG - Intergenic
980864184 4:138535489-138535511 TTGTTGTGGTGTGAAAGCAGAGG - Intergenic
981944262 4:150322832-150322854 ATCTGATGGTGTGAAAACACAGG + Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561860 4:156937785-156937807 GTATTGTATTGTGTAAACACAGG - Intronic
983360205 4:166717271-166717293 GTGTTGGGGTGTGGAAATAAGGG - Intergenic
984600964 4:181726586-181726608 TTGCTGTGGTGTGAGAACAGAGG - Intergenic
984983185 4:185302536-185302558 TTGTTGTGGTGTGAAAGCAAAGG + Intronic
985505252 5:275875-275897 GAGGTGTGGTGGAAAAACACAGG - Intronic
985742875 5:1629745-1629767 GAGGTGTGGTGGAAAAACACAGG + Intergenic
985896590 5:2752621-2752643 GATTTGTGTTGTCAAAACACTGG + Exonic
986098320 5:4582145-4582167 GTGTAGCGGTGTCAAAACACAGG + Intergenic
987836496 5:23169639-23169661 TTGTTGTGGTGTGATAGCAGAGG - Intergenic
989136598 5:38162054-38162076 GTGTTGTTGAATGAAAACAAAGG - Intergenic
990232458 5:53728089-53728111 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
991012281 5:61896720-61896742 GTGGTGTGGTATGGAGACACAGG - Intergenic
992509686 5:77420679-77420701 GTGTTGTGCTGTGGAATCCCTGG - Intronic
996031079 5:118704371-118704393 GTGTTGTGGTAGGAACACAGTGG - Intergenic
1000416446 5:160988703-160988725 TTGTTGAGGTGTGAAAACAGAGG + Intergenic
1000520225 5:162285654-162285676 GCGTTGAAGTGTGAAAACCCTGG + Intergenic
1001217169 5:169866787-169866809 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1001612723 5:173016373-173016395 TTATTGTGGTGTGAAAGCAGAGG + Intronic
1002096195 5:176832556-176832578 GTGGTGTGTGGTGAGAACACAGG + Intronic
1002295036 5:178225708-178225730 TTGTTGTAGTGTGAAAGCAGAGG - Intronic
1002611654 5:180423024-180423046 GGTTTGTAGTGTGAATACACAGG + Intergenic
1004687203 6:17957768-17957790 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1005194792 6:23270548-23270570 TGGTTGTGGTGTGAGAACAGGGG - Intergenic
1005409530 6:25528655-25528677 GTTTTGTGGGGTCAAAGCACTGG + Intronic
1006720509 6:36147214-36147236 GAGTCGTGGTGAGAAAACAGAGG - Intergenic
1008180834 6:48326443-48326465 GTCTTTTGTTGTTAAAACACTGG + Intergenic
1011239725 6:85258190-85258212 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1011391094 6:86854580-86854602 TTGTTGTGGTGTGAGAATAGAGG - Intergenic
1011713615 6:90080928-90080950 GACTTGTGTTGTAAAAACACAGG + Intronic
1011848892 6:91601506-91601528 TTGTTGTAGTGTAAGAACACAGG + Intergenic
1012607624 6:101177502-101177524 GAGTTGTGCTGTGAAGTCACTGG + Intergenic
1013075024 6:106763638-106763660 GTGTTGTGGTGAGAGAGCAGAGG + Intergenic
1015994444 6:138983995-138984017 GTGTTTTGGTGAGAATACAGTGG - Intronic
1017120577 6:151020185-151020207 GTCTTGTGGAAGGAAAACACCGG + Intronic
1018772703 6:166986078-166986100 CTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1018881492 6:167886803-167886825 CTGTTGTGGTGTGAACACTGAGG + Intronic
1020464714 7:8464451-8464473 GTGTAGTGGGGTAAAAAGACTGG - Intronic
1020650868 7:10874557-10874579 GTGTGGTGTTGTGAAAACATGGG + Intergenic
1022439620 7:30422741-30422763 CTTTTGTGCTGTGAAGACACAGG + Intergenic
1022612713 7:31893160-31893182 AAGTTGGGGTGTGAAAACACAGG + Intronic
1023069711 7:36417484-36417506 TTGTGGTGGTATGAAAACAGAGG - Intronic
1023155440 7:37246603-37246625 TTGTTGTGATGAGAGAACACTGG + Intronic
1023177257 7:37447187-37447209 GGGTTTTGGTGTGTAAATACAGG + Intronic
1024136134 7:46411335-46411357 TTGTTGTGGTGTGAGAACAGAGG - Intergenic
1024368005 7:48545018-48545040 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1027293686 7:76744490-76744512 TTGTTGTGGTGTGAGAGTACAGG - Intergenic
1031153491 7:118082009-118082031 GTATTGTGGTGATAAAATACTGG - Intergenic
1035966642 8:4199380-4199402 GTGTGGTGGAGTGAAAAGAATGG + Intronic
1037429641 8:18796259-18796281 GTGCTATGATGGGAAAACACTGG - Intronic
1038765941 8:30427753-30427775 GGGTTGTGGGGTTAGAACACAGG + Intronic
1043075093 8:75688993-75689015 GTGTTTTGGAGTGACAGCACAGG - Intergenic
1044645648 8:94440631-94440653 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1049126173 8:140790905-140790927 CTGTTGTGCTGCCAAAACACTGG + Intronic
1049137970 8:140922832-140922854 GTGCTGTGGTGTGAAGACCCTGG - Intronic
1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG + Intronic
1051875769 9:21791442-21791464 TTGTTATGGTGTGAGAGCACAGG + Intergenic
1052984813 9:34479124-34479146 GTGGAGAGGTGGGAAAACACAGG + Intronic
1053014346 9:34653648-34653670 GTCTGGCTGTGTGAAAACACAGG + Intronic
1054911190 9:70456689-70456711 CTGGTGTGAAGTGAAAACACAGG - Intergenic
1054918901 9:70522354-70522376 CTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1055250114 9:74293709-74293731 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1056373167 9:85979726-85979748 TTGTGGTGGTGTGAGAGCACAGG - Intronic
1057547806 9:96031244-96031266 GTGAAGTGGTGTGAATACAATGG + Intergenic
1057711419 9:97449178-97449200 TTGTTGTGGTGTGACAGCAGAGG - Intronic
1058210771 9:102167268-102167290 GTGATGTGGTGTGACAACTTGGG - Intergenic
1060190698 9:121590436-121590458 GTGTTGTGGTTACAAAACCCAGG + Intronic
1061531245 9:131215236-131215258 GTGTTTGGGTCTGGAAACACTGG + Exonic
1061565100 9:131433440-131433462 GTGTGGTGGGCTGAAAACACAGG + Intronic
1185936407 X:4261959-4261981 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1186817763 X:13254788-13254810 GTGATGAGGTGTGCAAACAGTGG - Intergenic
1189746282 X:44171990-44172012 GTATTGTTGGGTGAAATCACAGG + Intronic
1190224021 X:48531837-48531859 GTGTTCTGGTGAGAAGACAAAGG - Intergenic
1191943443 X:66503943-66503965 TTGTTGTGGTGTGAAAATAGAGG + Intergenic
1192542144 X:71983145-71983167 TTGTTGTGGTGTGAGAACAGAGG + Intergenic
1196581117 X:117380169-117380191 GTGTTGTTGTGTGAGAAGAATGG - Intergenic
1196783620 X:119403772-119403794 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1196801920 X:119551672-119551694 TTGTTGTGGTGTGAGATCAGAGG - Intronic
1198256888 X:134931934-134931956 CTGTGGTGGTGTGAAAGCAGAGG - Intergenic
1199870220 X:151891778-151891800 GTGGTGTGGTGGGAAATCACTGG - Intergenic