ID: 1100413530

View in Genome Browser
Species Human (GRCh38)
Location 12:94347393-94347415
Sequence GAAAATAACAAGTGTCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2083
Summary {0: 1, 1: 6, 2: 80, 3: 471, 4: 1525}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100413528_1100413530 1 Left 1100413528 12:94347369-94347391 CCAATTAGAATTATTATTAAGAC 0: 1
1: 0
2: 0
3: 44
4: 388
Right 1100413530 12:94347393-94347415 GAAAATAACAAGTGTCAGTAGGG 0: 1
1: 6
2: 80
3: 471
4: 1525
1100413527_1100413530 26 Left 1100413527 12:94347344-94347366 CCACAGGTGACATGTTACAACAT 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1100413530 12:94347393-94347415 GAAAATAACAAGTGTCAGTAGGG 0: 1
1: 6
2: 80
3: 471
4: 1525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100413530 Original CRISPR GAAAATAACAAGTGTCAGTA GGG Intronic
Too many off-targets to display for this crispr