ID: 1100414360

View in Genome Browser
Species Human (GRCh38)
Location 12:94356390-94356412
Sequence CACCCCCTCATTATTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100414352_1100414360 29 Left 1100414352 12:94356338-94356360 CCAGCTAAAGCTAAAGCGGCAAA 0: 33
1: 95
2: 28
3: 19
4: 75
Right 1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG 0: 1
1: 0
2: 0
3: 27
4: 262
1100414356_1100414360 -10 Left 1100414356 12:94356377-94356399 CCCTACCCTTCTGCACCCCCTCA 0: 49
1: 61
2: 47
3: 69
4: 403
Right 1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG 0: 1
1: 0
2: 0
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100414360 Original CRISPR CACCCCCTCATTATTTTTTG AGG Intronic
904976106 1:34457828-34457850 CACCCCCATAATATGTTTTGGGG + Intergenic
905970510 1:42138301-42138323 CACCACCCCATTGTCTTTTGGGG + Intergenic
906104693 1:43284813-43284835 CACGCCCTCCTCAGTTTTTGGGG + Intronic
906343018 1:44997285-44997307 CACCAACTAATCATTTTTTGTGG - Intergenic
907482186 1:54752974-54752996 CCGCCTCTCTTTATTTTTTGAGG + Intergenic
907711233 1:56883913-56883935 CCCCCCATCATCATTTTTTATGG + Intronic
907762146 1:57371554-57371576 CACCCACTCAATATTTACTGGGG + Intronic
908105788 1:60840657-60840679 CATGACCTCATTATTTTTTACGG - Intergenic
909777108 1:79495034-79495056 CACTCCTTCATTTTTATTTGGGG - Intergenic
910873346 1:91854611-91854633 CACACACTTATCATTTTTTGTGG - Intronic
911942509 1:104065721-104065743 CAGCATCTCATTATTTTTTATGG + Intergenic
912891887 1:113542109-113542131 CCCCCCCTCCTTATTCTTGGGGG + Intronic
913943291 1:125128737-125128759 CACGAACTCATCATTTTTTGTGG - Intergenic
915789618 1:158653931-158653953 GGCCTCTTCATTATTTTTTGAGG - Intronic
915802763 1:158811424-158811446 CACCATATCATTATTTTATGTGG + Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
916626824 1:166567212-166567234 CAACACCTCATTAGCTTTTGAGG + Intergenic
916711012 1:167408524-167408546 CAACACCTCATTAATTTTTATGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918911908 1:190584142-190584164 CACTACCTCATCATTTTTTGTGG - Intergenic
919588035 1:199463463-199463485 CACCCCCTCAGGATCTTGTGTGG - Intergenic
920540270 1:206772972-206772994 CACCCCCTCATTTTTACTTGGGG - Intergenic
921994266 1:221399891-221399913 CAACCCCTGATATTTTTTTGGGG - Intergenic
924830186 1:247585893-247585915 CACGACTTCATTATTTTTTATGG - Intergenic
1063008004 10:1993331-1993353 CACCACCCCAATATTTCTTGAGG + Intergenic
1064737627 10:18399018-18399040 CACCCACACATAATTTTGTGCGG - Intronic
1065549779 10:26859348-26859370 CTTCCCCTCTTTATTTTTAGAGG - Intronic
1068318365 10:55377875-55377897 CATGACCTCATTATTTTTTATGG - Intronic
1068551360 10:58411418-58411440 CATGACCTCATTCTTTTTTGTGG + Intergenic
1068554710 10:58446565-58446587 CACAATCTCATTATTTTTTATGG + Intergenic
1069155321 10:65022379-65022401 CATCACCTCATTCTTTTTTACGG - Intergenic
1069948774 10:72005357-72005379 ATCCACCTCATTATTCTTTGTGG + Intronic
1070701671 10:78606498-78606520 CACGAACTCATCATTTTTTGTGG + Intergenic
1070738560 10:78885186-78885208 CATCCCTTTTTTATTTTTTGAGG - Intergenic
1072861955 10:99015486-99015508 CACGAACTCATTATTTTTTATGG - Intronic
1074093046 10:110281209-110281231 CTCACCCTCAATATTTTTTCTGG + Intronic
1074570875 10:114622898-114622920 CACTCCCTCTTTAATCTTTGAGG - Intronic
1077880709 11:6347245-6347267 CACTCCCTGTTTATTTTTTAAGG + Intergenic
1078125303 11:8555722-8555744 CATCACCTCACTTTTTTTTGTGG - Intronic
1079277159 11:19051985-19052007 CATGACCTCATTATTTTTTATGG - Intergenic
1079957804 11:26885796-26885818 TACCCCTTTATCATTTTTTGTGG - Intergenic
1079959022 11:26899876-26899898 TGCCCCATCATTATTTGTTGTGG + Intergenic
1080508366 11:32941554-32941576 CACGAACTCATCATTTTTTGTGG + Intronic
1080683361 11:34496078-34496100 CACCCCCTTGTTATTTTCTTTGG + Intronic
1081000162 11:37659558-37659580 CACGAACTCATCATTTTTTGTGG - Intergenic
1081105750 11:39067005-39067027 CATCCCTTTCTTATTTTTTGTGG + Intergenic
1081631159 11:44690939-44690961 CACCCCCTCCTTTTCTTTGGTGG + Intergenic
1082904262 11:58289248-58289270 CACCGACTTATTTTTTTTTGTGG - Intergenic
1083333013 11:61907744-61907766 CATCCCCTCGTCATTTTATGTGG + Intronic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1086022073 11:82242265-82242287 CACAATCTCATTATTTTTTATGG + Intergenic
1086310206 11:85527519-85527541 CATGCACTCATTATTTTTTATGG + Intronic
1087117391 11:94540447-94540469 CACCACCTCATTTTTTCTTTTGG + Intergenic
1087351107 11:97033628-97033650 TACCTTCTGATTATTTTTTGTGG + Intergenic
1087416594 11:97864350-97864372 CATGACCTCATTATTTTTTATGG - Intergenic
1087485764 11:98758248-98758270 CAGGCCCTCAATATTTTTTAAGG - Intergenic
1087573430 11:99960859-99960881 CTTCTCCTCATTATTTTTTGTGG - Intronic
1094123022 12:26994017-26994039 CATACCCTCATTAGTCTTTGAGG + Intronic
1094321065 12:29183910-29183932 TACCACCTCATTATTTTATTAGG + Intronic
1095470670 12:42533677-42533699 CTCTCTCTCTTTATTTTTTGTGG - Intronic
1096309565 12:50508519-50508541 CACCGCCCCTTTCTTTTTTGTGG + Intronic
1096439409 12:51627361-51627383 CATTCCCTCAATATTTTCTGAGG - Intronic
1096739336 12:53680900-53680922 CACGCCCTAATTATTTTTGTGGG + Intergenic
1098852730 12:75616780-75616802 CATCATCTCATTCTTTTTTGTGG - Intergenic
1100266820 12:92985201-92985223 CATGCTCTCATTATTTTTTATGG - Intergenic
1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG + Intronic
1100529501 12:95450787-95450809 AACCCCCCCTTTTTTTTTTGCGG + Intergenic
1100694455 12:97076830-97076852 CACCCTCTCTTCATTTTTTAGGG + Intergenic
1101566892 12:105914955-105914977 CACGTACTTATTATTTTTTGTGG + Intergenic
1101625289 12:106434807-106434829 CACTACCTCATTTTCTTTTGAGG + Intronic
1101919033 12:108917941-108917963 CACCACCTCATTCTTTTTAATGG + Intronic
1102981702 12:117246801-117246823 CACCACTTCATTCTTTTTTATGG + Intronic
1103178066 12:118881738-118881760 CAGCACCTCATTCTTTTTTATGG + Intergenic
1104052049 12:125201975-125201997 CACACCCTCATTTTCTTTTGGGG + Intronic
1104557175 12:129811495-129811517 CACCCCATCTTTATCATTTGGGG + Intronic
1105388255 13:19952406-19952428 CACATACTTATTATTTTTTGTGG - Intergenic
1105410682 13:20168781-20168803 CAACCCCTCTTTATAGTTTGTGG - Intergenic
1105872591 13:24518849-24518871 CATCAACTCATTATTTGTTGGGG + Intergenic
1107420511 13:40241858-40241880 CACCCCCTTTTTTTTTTTTTAGG + Intergenic
1107703956 13:43080382-43080404 CACGATCTCATTACTTTTTGTGG + Intronic
1108457053 13:50626803-50626825 CCCCACCTCATTGTCTTTTGGGG - Intronic
1109018188 13:57048026-57048048 CACAATCTCATTCTTTTTTGTGG + Intergenic
1109259311 13:60124433-60124455 CAACACCTCACTATTTTTTGGGG + Intronic
1110461437 13:75749823-75749845 CACCCCCACCTTTTTTTTTTTGG + Intronic
1111512874 13:89288324-89288346 CAGCATCTCATTGTTTTTTGTGG + Intergenic
1111538782 13:89642540-89642562 CACAATTTCATTATTTTTTGTGG + Intergenic
1111549977 13:89795607-89795629 CACGACCTCATTATTTTTTATGG - Intergenic
1112608993 13:100937510-100937532 CATGACCTCATTCTTTTTTGTGG + Intergenic
1115530377 14:34321466-34321488 CAACCCTTCTTTTTTTTTTGAGG - Intronic
1115988604 14:39128258-39128280 CACCCCCTCTTTTTTTTTTTAGG + Exonic
1116975525 14:51111517-51111539 CATGACCTCATTCTTTTTTGTGG - Intergenic
1117601377 14:57379433-57379455 CGGCCCCTAATTATTTTTTAAGG - Intergenic
1118304725 14:64646202-64646224 TGCCCCCTCCTTTTTTTTTGCGG + Intergenic
1122391209 14:101386419-101386441 CACGATCTCATTCTTTTTTGTGG + Intergenic
1122484658 14:102070714-102070736 CACCCCCTGCTTATTTTGTGCGG - Intergenic
1122824969 14:104365571-104365593 CATCAACACATTATTTTTTGTGG - Intergenic
1127177400 15:56374872-56374894 CAGGGCCTCATTATTTTTTATGG + Intronic
1127290539 15:57566553-57566575 CAGCTCTTCATTATTTTTTAAGG + Intergenic
1128225551 15:65998973-65998995 CACCCCCTCATTCTGTCTAGCGG + Intronic
1129149360 15:73678009-73678031 CAGCCCTTCATTATTCTTTAGGG - Intergenic
1129181275 15:73878268-73878290 CACCCACTCATTTTTGTCTGTGG - Intronic
1131728762 15:95256450-95256472 CACCATCTAATTAGTTTTTGTGG + Intergenic
1131857485 15:96613560-96613582 CAGTACTTCATTATTTTTTGTGG + Intergenic
1135013119 16:18901942-18901964 CACCCCCCCCTTTTTTTTTTTGG - Intronic
1135336940 16:21609658-21609680 CACCCCTTCCTTCTTTTTTCTGG - Intronic
1136138780 16:28275578-28275600 GACCCCCTCATTCTTTTTCCAGG - Intergenic
1137083231 16:36092245-36092267 CACGAACTCATCATTTTTTGTGG + Intergenic
1137438243 16:48476004-48476026 CACCATCTCATTCTTTTTTATGG - Intergenic
1137573379 16:49581105-49581127 CCCCCCTTGTTTATTTTTTGGGG - Intronic
1141353487 16:83321484-83321506 TACCTCCTCATTTTTTTTTCTGG + Intronic
1143114144 17:4571893-4571915 CACCACCCCATTATGATTTGAGG + Intergenic
1146087915 17:29847467-29847489 GACCCCCTCAGGTTTTTTTGAGG + Intronic
1150998451 17:70346243-70346265 CCCACCCTCATTATTTATAGAGG - Intergenic
1151565751 17:74896966-74896988 CTCCCCATCATTAGTTTTTAGGG + Intergenic
1151686676 17:75651321-75651343 GGCCTCCTCATTACTTTTTGTGG - Intronic
1152256963 17:79245537-79245559 CACCCCCTCAGTCCTTTGTGAGG + Intronic
1153722688 18:7922951-7922973 CACCCGCTAATTTTTTGTTGTGG + Intronic
1154142752 18:11839725-11839747 CAGCTCCTCATTCCTTTTTGCGG - Intronic
1154325099 18:13384392-13384414 CACCAACTTATCATTTTTTGTGG + Intronic
1155451590 18:25969314-25969336 CACCACCTCTTTCTCTTTTGTGG + Intergenic
1156909828 18:42398402-42398424 CACCCCATCATTATTTTCTTTGG - Intergenic
1159907412 18:74108075-74108097 CACCACATTACTATTTTTTGTGG + Intronic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1166577295 19:43854019-43854041 CTCTCCCTTATTATTTTCTGTGG - Intergenic
1168514228 19:56997454-56997476 CACCTACTTATCATTTTTTGTGG - Intergenic
1168550901 19:57292671-57292693 CATCCCCTCCTTATTTTATTTGG + Exonic
925933018 2:8725551-8725573 CACCCCCTTATTATTTGGTGAGG + Intronic
927115768 2:19900928-19900950 CTTCCCCTCTTTATTTGTTGAGG - Intronic
927402241 2:22725762-22725784 CACCAACTCATTTTTTTGTGGGG - Intergenic
928276394 2:29904473-29904495 TTTCCCCTCATTATTTTTTGTGG - Intronic
929474151 2:42228286-42228308 CACCCACTCATTTTTCTATGAGG - Intronic
931090647 2:58882537-58882559 CATGAGCTCATTATTTTTTGTGG - Intergenic
932548481 2:72741100-72741122 CACCCCCCCTTTTTTTTTTGAGG - Intronic
933935226 2:87198517-87198539 CATACCCTCAGGATTTTTTGAGG - Intergenic
934846892 2:97667111-97667133 CACTCTCTCATTATTTTTAATGG - Intergenic
935241280 2:101180184-101180206 CACTCCCTCATTCTGTTCTGAGG - Intronic
936027430 2:109044151-109044173 CTCCCCTTCATTATTTATTTAGG - Intergenic
936256644 2:110921392-110921414 CCCCCCCCCTTTTTTTTTTGAGG + Intronic
936273480 2:111070322-111070344 CACGAGCTCATTCTTTTTTGTGG - Intronic
936357923 2:111767382-111767404 CATACCCTCAGGATTTTTTGAGG + Intronic
936643608 2:114343994-114344016 CACCTACTTACTATTTTTTGTGG - Intergenic
937246208 2:120495624-120495646 CAACTCCCCATTATTTTTTTAGG - Intergenic
939197693 2:138992438-138992460 CACAATCTCATTATTTTTTATGG - Intergenic
939347851 2:140990613-140990635 CACCTCCTAAGTATTTTCTGTGG - Intronic
939461489 2:142502050-142502072 CACCCCATCATGCCTTTTTGTGG - Intergenic
939494490 2:142912083-142912105 CACCCCCTCCTTAATTTTTTGGG + Intronic
940133185 2:150407159-150407181 CACCTCCTCATTAGTTTCTATGG + Intergenic
944042630 2:195373539-195373561 CACCAACTCATCATTTTTTATGG + Intergenic
947311718 2:228810092-228810114 CACGATCTCATTATTTTTTATGG + Intergenic
947318575 2:228892111-228892133 CAAACCCTTAATATTTTTTGAGG + Intronic
948036772 2:234864008-234864030 CCCCCCATGATTATTTTTTAGGG + Intergenic
948158729 2:235806658-235806680 TTCCCCTTCATTATTTTTTGTGG + Intronic
1169250370 20:4056118-4056140 CTTACCTTCATTATTTTTTGGGG + Intergenic
1170228306 20:14016880-14016902 CATCCCAACAGTATTTTTTGTGG - Intronic
1170509613 20:17063398-17063420 CACTCCCTCATTGTGTTTTGTGG - Intergenic
1175164046 20:57030459-57030481 CAGCCCCTCATTATTCTTGGGGG + Intergenic
1177464715 21:21460773-21460795 CACACCCTCATTATTGTATTTGG - Intronic
1178345468 21:31822924-31822946 CACATACTTATTATTTTTTGTGG - Intergenic
1178494971 21:33078839-33078861 GACCCCCACAGTATTTTTTGAGG + Intergenic
1178643329 21:34364163-34364185 CACACATTCTTTATTTTTTGAGG + Intronic
1179372142 21:40816311-40816333 CACCCCCTCTTTTTATTTGGGGG - Intronic
1179501669 21:41813096-41813118 CACCTCCCCATCAGTTTTTGGGG - Intronic
1180697256 22:17759793-17759815 CACTGTCTCCTTATTTTTTGTGG - Intronic
1181149928 22:20875857-20875879 CGCCCCCCCATTTTTTTTTTTGG - Intronic
1203324053 22_KI270737v1_random:100198-100220 CACAAACTCATCATTTTTTGTGG + Intergenic
949744978 3:7280159-7280181 TACCCCTTCTTTATTGTTTGGGG + Intronic
950942419 3:16906202-16906224 CAGCCCCACAATATTTTTAGGGG - Intronic
952719968 3:36522428-36522450 TACCCCATCAATATTTTTTGAGG - Intronic
954041961 3:47895020-47895042 CACCCCCTTTTTTTTTTTTTTGG - Intronic
954361720 3:50125774-50125796 CAGCCCCTCATTATCTACTGGGG + Intergenic
955051668 3:55416598-55416620 CACACCCTCATTTTTTTTGGAGG - Intergenic
955157308 3:56429302-56429324 TAGCCCCTTATTATTTTTAGTGG - Intronic
955436908 3:58910264-58910286 CACCCACTCACTCATTTTTGTGG + Intronic
956456594 3:69427186-69427208 TAACCCCTCAATATTTTCTGTGG + Intronic
956811816 3:72870794-72870816 CACCTCCAAAATATTTTTTGTGG + Intergenic
956903821 3:73744582-73744604 TACCCATTCATTATTTTTTATGG + Intergenic
957454956 3:80429538-80429560 CACGATCTCATTATTTTTTATGG + Intergenic
957633450 3:82748757-82748779 CATCATCTCATTATTTTTTATGG - Intergenic
959336372 3:105070386-105070408 CAGAACCTCATTATTTTTTATGG - Intergenic
960204358 3:114877011-114877033 CACCACTACATTATTTATTGTGG - Intronic
960431231 3:117571192-117571214 CAACCCATTATTATTTTTTTTGG + Intergenic
963715076 3:148793870-148793892 CACCCCCCCTTTTTTTTTGGGGG - Intronic
964170085 3:153759470-153759492 CACCTTCTCATTATGTTTTCAGG - Intergenic
964675261 3:159271252-159271274 CACCCCCTTCTTATTTTCTCAGG - Intronic
965087870 3:164122859-164122881 CATGACCTCATTATTTTTTATGG - Intergenic
966403018 3:179565809-179565831 CACCCCCTAATTTTTTTTGAAGG + Intronic
967104167 3:186242126-186242148 CAGCCCCTCATGATTCTTTTGGG - Intronic
967762913 3:193245024-193245046 CACCAATTTATTATTTTTTGTGG + Intronic
970305196 4:14724521-14724543 CATAAACTCATTATTTTTTGTGG - Intergenic
970339212 4:15086600-15086622 CACCCCCTGCTTTTTTTTTGAGG - Intergenic
971297918 4:25415851-25415873 CATCACCTCATAATTTTTTTTGG - Intronic
973931394 4:55796241-55796263 AACCCCCTCATTAGGTTTTAAGG + Intergenic
974514649 4:62894053-62894075 CACACACACAATATTTTTTGTGG + Intergenic
974560620 4:63512024-63512046 CACAAACTCATTATTTTTTATGG - Intergenic
974745691 4:66072549-66072571 CTCCTCCTCATTTTTTTTTTTGG + Intergenic
976232119 4:82855607-82855629 CACGATCTCATTCTTTTTTGTGG - Intronic
977091035 4:92676162-92676184 CCCCCCCCCTTTTTTTTTTGTGG + Intronic
979692526 4:123575011-123575033 CACTCCCTCATTATCTCTAGAGG - Intergenic
980639488 4:135557298-135557320 CACGCCCTCATCATTTTAGGTGG - Intergenic
980860575 4:138495059-138495081 CATCCCTTCTTTATTTTCTGAGG - Intergenic
981137022 4:141221464-141221486 CACCTCGTGATTATTTTCTGAGG + Intronic
981406347 4:144374223-144374245 CACCCACTAATTATTTGGTGAGG + Intergenic
986069642 5:4269504-4269526 CACCTCCTCCTTATTCTGTGTGG - Intergenic
988348917 5:30075255-30075277 CTCCTCCTCATTTTTTTTTGTGG - Intergenic
988814039 5:34814801-34814823 TACCCCTTGATTATTTTTTCTGG + Intronic
988815478 5:34830280-34830302 CACCCTCCCATCATTTATTGAGG + Intronic
990593545 5:57290953-57290975 CAGACTCTCATTCTTTTTTGTGG - Intergenic
990786945 5:59431951-59431973 CACGCTCTCATTCTTTTTTATGG + Intronic
990812394 5:59742840-59742862 TTCCCACTCATTCTTTTTTGGGG - Intronic
991018558 5:61957409-61957431 CATGACCTCATCATTTTTTGTGG - Intergenic
993425428 5:87757915-87757937 CATTCTTTCATTATTTTTTGTGG - Intergenic
994429511 5:99639664-99639686 TACCCCTTAATTATTTTTAGTGG - Intergenic
995129490 5:108614680-108614702 CAGCCCCTATTTATTTATTGAGG + Intergenic
996524872 5:124468232-124468254 CACCTTCTCTTTTTTTTTTGTGG - Intergenic
996609208 5:125359324-125359346 CATGAACTCATTATTTTTTGTGG + Intergenic
999034660 5:148334072-148334094 GACCCCCTCATTATTCTTCTTGG - Intronic
1000232208 5:159326667-159326689 CAGCCTCTCATTATTCTCTGTGG - Intronic
1003495089 6:6656790-6656812 CAGCCCTTCTTTATATTTTGAGG + Intergenic
1004687237 6:17958267-17958289 AACCCCTTCAGTATCTTTTGAGG - Intronic
1006208542 6:32372594-32372616 CATCATCTCATTATTTTTTATGG - Intergenic
1011298420 6:85848211-85848233 CACGAACTCATTATTTTTTATGG + Intergenic
1011991716 6:93528526-93528548 CACCCCCTATTTATCTTTTTAGG - Intergenic
1012511680 6:100009875-100009897 CACCACCTCATAATGTTTTCTGG - Intergenic
1013152197 6:107457480-107457502 CAGCACCTAATTATTTCTTGTGG + Intronic
1013435450 6:110100948-110100970 TACCACCTCATTAATTTTTTAGG - Intronic
1014158346 6:118137770-118137792 CACCCCCTCATTCCACTTTGGGG - Intronic
1015567809 6:134591556-134591578 CACCCCCTCAATAGTTTTGGAGG + Intergenic
1016076999 6:139807508-139807530 CACCTTCTTAGTATTTTTTGAGG + Intergenic
1016587973 6:145710789-145710811 CATGAACTCATTATTTTTTGTGG - Intronic
1018298386 6:162374162-162374184 TAACCCCTCATGATTTTTGGAGG - Intronic
1018307667 6:162475257-162475279 CACCCATTCATTATTTATTGAGG + Intronic
1019805491 7:3120922-3120944 CAGCACCTCATTATGTGTTGAGG + Intergenic
1019892749 7:3959741-3959763 CACCCTTTTATTCTTTTTTGTGG + Intronic
1024237454 7:47409085-47409107 TTCCTCCTCATTATTTTCTGTGG - Intronic
1024242038 7:47443139-47443161 CACCTCCTCATTGTTTTTCCCGG + Intronic
1025479669 7:60966275-60966297 CACGAACTCATCATTTTTTGTGG - Intergenic
1026401531 7:70019079-70019101 CATGACCTCATTCTTTTTTGTGG - Intronic
1027415671 7:77971874-77971896 CACCTCTTCATTTTTTCTTGAGG + Intergenic
1029859219 7:103551357-103551379 CACCACTTCATTATTTTCTAGGG + Intronic
1030709112 7:112729184-112729206 CAGGATCTCATTATTTTTTGTGG + Intergenic
1031592081 7:123605661-123605683 CACAATCTCATTCTTTTTTGTGG - Intronic
1031637076 7:124114658-124114680 CACATCCTCATCCTTTTTTGTGG - Intergenic
1033500963 7:141949031-141949053 TACCCACACATTGTTTTTTGGGG + Intronic
1036215169 8:6873522-6873544 CACACCTTCATTCTTTTTTATGG - Intronic
1036499496 8:9300330-9300352 TACCACCTCATATTTTTTTGTGG - Intergenic
1037539877 8:19860845-19860867 CACCCCCTAATTTTAATTTGTGG + Intergenic
1038970572 8:32629029-32629051 CAGCCCCTGCTTATTTTTTAAGG + Intronic
1039223021 8:35356329-35356351 TACTCCCTCCTTATCTTTTGGGG + Intronic
1039354935 8:36804572-36804594 CATCCCCTCCTTATTTTTCAGGG + Intronic
1039562580 8:38524683-38524705 CAACTCCCCATTATTTATTGAGG - Intronic
1042831473 8:73033889-73033911 TACCCCCTCTTTATAGTTTGAGG + Intronic
1042933812 8:74038687-74038709 CAGACTCTCATTCTTTTTTGTGG + Intergenic
1043364158 8:79512273-79512295 CTCCCCCTCCTTTTTTTTGGGGG - Intergenic
1045091132 8:98744399-98744421 CATGAACTCATTATTTTTTGTGG - Intronic
1045226301 8:100249430-100249452 CACTACCTCATTCTTTTTTATGG - Intronic
1047660362 8:127027192-127027214 CACGATCTCACTATTTTTTGTGG - Intergenic
1048240443 8:132736385-132736407 CACCCACTCATGATTTTCTGAGG - Intronic
1048927347 8:139282692-139282714 GTCCCCCTGATTTTTTTTTGTGG - Intergenic
1049034051 8:140060775-140060797 CATCCCCCCATAATTTTTAGTGG + Intronic
1050776038 9:9261604-9261626 CACACACTCATTATTATTAGAGG - Intronic
1050811813 9:9758053-9758075 CACCCAATCAGTATTATTTGGGG - Intronic
1050848278 9:10251993-10252015 CACACACTTACTATTTTTTGTGG - Intronic
1052230142 9:26140653-26140675 TACCCCCTAATTATGTTTTCTGG - Intergenic
1053672212 9:40377914-40377936 CATGACCTCATTATTTTTTATGG - Intergenic
1053922028 9:43004273-43004295 CATGACCTCATTATTTTTTATGG - Intergenic
1054383325 9:64517958-64517980 CATGACCTCATTATTTTTTATGG - Intergenic
1054512412 9:65998396-65998418 CATGACCTCATTATTTTTTATGG + Intergenic
1055034887 9:71808069-71808091 AACCCCTTCATTGTTCTTTGTGG - Intronic
1056515105 9:87342868-87342890 CACAATCTCATTATTTTTTCAGG - Intergenic
1056689706 9:88797336-88797358 CACCAACTTATTATTTTTTGTGG + Intergenic
1058797104 9:108509634-108509656 CACGAACTCATCATTTTTTGTGG - Intergenic
1059580071 9:115535904-115535926 CACCTACTTATTATTTTTTGTGG + Intergenic
1060123150 9:121015368-121015390 CAGCCCCTCAATATTTGTTAAGG - Intronic
1060418561 9:123450618-123450640 GATCCCCTCATACTTTTTTGTGG + Intronic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1062227120 9:135458662-135458684 CACGGTCTCATTATTTTTTATGG + Intergenic
1062690355 9:137838217-137838239 CACCCCCTCAGGGTCTTTTGAGG + Intronic
1186467962 X:9798994-9799016 CTCCCCCTCCTCATTTTTAGTGG + Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1187760586 X:22579731-22579753 CACGACCTCATCATTTTTTATGG - Intergenic
1188184675 X:27099232-27099254 AACCCTCTCATTATTTTTAATGG + Intergenic
1188190723 X:27168845-27168867 TACCACCTAATTATTTTATGTGG + Intergenic
1188741068 X:33782397-33782419 AAGCCCCTCATTATTTTTGTGGG - Intergenic
1189620841 X:42835671-42835693 CACCCAGCCATTATTTCTTGTGG + Intergenic
1189639463 X:43051885-43051907 CACACACTCACCATTTTTTGTGG + Intergenic
1190912346 X:54785011-54785033 CAGGACCTCATTCTTTTTTGTGG - Intronic
1195284670 X:103372288-103372310 CAGCACCTCATTATCTATTGGGG - Intergenic
1195768946 X:108328116-108328138 CATCCCTTCATTAATTTTTATGG - Intronic
1200365633 X:155659436-155659458 CACCCAGCCTTTATTTTTTGAGG + Intronic
1202063355 Y:20911477-20911499 AAACCTCTCATTATTTTTAGTGG + Intergenic