ID: 1100416664

View in Genome Browser
Species Human (GRCh38)
Location 12:94385112-94385134
Sequence GGGTATCAACAGAAGTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100416664_1100416673 17 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416673 12:94385152-94385174 CATGATACCCATAATGAACAGGG 0: 1
1: 0
2: 1
3: 8
4: 108
1100416664_1100416675 21 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416675 12:94385156-94385178 ATACCCATAATGAACAGGGGTGG 0: 1
1: 0
2: 2
3: 8
4: 86
1100416664_1100416676 22 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416676 12:94385157-94385179 TACCCATAATGAACAGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 98
1100416664_1100416674 18 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416674 12:94385153-94385175 ATGATACCCATAATGAACAGGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1100416664_1100416672 16 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416672 12:94385151-94385173 TCATGATACCCATAATGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1100416664_1100416679 30 Left 1100416664 12:94385112-94385134 CCACTCTACTTCTGTTGATACCC 0: 1
1: 1
2: 0
3: 16
4: 150
Right 1100416679 12:94385165-94385187 ATGAACAGGGGTGGGAGTTCTGG 0: 1
1: 0
2: 4
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100416664 Original CRISPR GGGTATCAACAGAAGTAGAG TGG (reversed) Intronic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
904874185 1:33641424-33641446 GGATATCAACAGAACCAGTGGGG - Intronic
905635582 1:39549356-39549378 TGGTATGAACACAAGTAGAGTGG - Intergenic
909346618 1:74596020-74596042 GGGTTTGAAAAGAAGTATAGGGG - Intronic
913973196 1:143432365-143432387 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
914067580 1:144257972-144257994 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
914111573 1:144708382-144708404 AGGTATAAAAAGAAGTAGAGAGG + Intergenic
914906377 1:151749450-151749472 GAGTGTCAACAGAGGTACAGTGG - Intergenic
915939550 1:160110073-160110095 GGGGATCATCAGAACTGGAGAGG + Intergenic
918840725 1:189534212-189534234 GGGCTACAACAGAAATAGAGAGG + Intergenic
921239122 1:213159127-213159149 GAGTATCAACAGAAGTTTAAGGG - Intronic
924886938 1:248229066-248229088 GGATATCAGCAGAAGCAGGGTGG + Intergenic
1064521010 10:16200836-16200858 GTGTGTGAACAGAAGTAGACTGG + Intergenic
1064594178 10:16926561-16926583 TGGTAGCAACAGAAATGGAGAGG + Intronic
1065119746 10:22516727-22516749 GGGTATCGAAAGCAGGAGAGAGG + Intergenic
1067010844 10:42712114-42712136 TGGTAGCAACAGAAATGGAGAGG + Intergenic
1067100753 10:43332797-43332819 AGATAGCAACAGAAGTACAGCGG - Intergenic
1067312669 10:45129095-45129117 TGGTAGCAACAGAAATGGAGGGG - Intergenic
1067553559 10:47252471-47252493 GGGGATGAACAGCAGGAGAGAGG + Intergenic
1069378949 10:67822504-67822526 GGGTCTGAAGAGAAGAAGAGAGG + Intronic
1072854833 10:98936010-98936032 GGGTATCTAGAGAAGTAGTCTGG + Intronic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073878193 10:107950026-107950048 GGGGAGCAAGAGAAGGAGAGGGG - Intergenic
1074939844 10:118223631-118223653 GGGTATCAACAGAGGCCAAGAGG + Intergenic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1079953283 11:26830966-26830988 GAGTATGAGCAGAAGTAGACTGG + Intergenic
1086436696 11:86788288-86788310 GGGCACCAAGAGAAGCAGAGAGG + Intergenic
1088866932 11:113856991-113857013 AGCTATCATCAGAAGTAGAGAGG + Intronic
1089345976 11:117792136-117792158 GGGGATGGACAGAGGTAGAGAGG - Intronic
1091330428 11:134727669-134727691 GGGTATAAACTGAATTAGACCGG + Intergenic
1093000537 12:13990982-13991004 GGGCATGAACAGAAGTTCAGAGG + Intergenic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1095529364 12:43167270-43167292 GGAAATCAAGAGAAGTGGAGTGG - Intergenic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1100735015 12:97518723-97518745 AGGTAAAGACAGAAGTAGAGAGG - Intergenic
1104551989 12:129765650-129765672 GGGTATCCACAAAAGGAGATGGG - Intronic
1107674356 13:42779170-42779192 GGGGATAAACAGCAGTAGAGTGG + Intergenic
1110012278 13:70352292-70352314 GTGTATCATCAGAGATAGAGTGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110998311 13:82142287-82142309 TTGTATAAACAGAAGTAAAGAGG - Intergenic
1111581532 13:90229978-90230000 AGGTATCAGTAGAAGTAAAGAGG - Intergenic
1112891365 13:104236412-104236434 GGGTATCAATGGTAGTAGATAGG - Intergenic
1115490518 14:33953540-33953562 GGGTTCAAGCAGAAGTAGAGAGG - Intronic
1116529212 14:45946849-45946871 GGTTATCAACAGAGCCAGAGGGG + Intergenic
1119085356 14:71733875-71733897 GTGTGTCCAGAGAAGTAGAGTGG - Intronic
1119829801 14:77691956-77691978 TGGTATCAACAGGAGCAGTGAGG - Intronic
1121870515 14:97402857-97402879 GGGGATCAAATGAAGAAGAGAGG - Intergenic
1122588246 14:102826145-102826167 GGGTATCTACAAAAGCAGAAGGG + Intronic
1122922836 14:104887023-104887045 CGGCATCCACAGAATTAGAGAGG - Exonic
1124583947 15:30988257-30988279 GGGTAAGAACAGAAGGGGAGAGG + Intronic
1124659252 15:31531956-31531978 AGGTATCAACAGGGGCAGAGGGG + Intronic
1127455810 15:59155091-59155113 GGGTCCCAACAAAAGGAGAGGGG + Intronic
1128249422 15:66153978-66154000 GGGTATCAACAGCTGCAGGGGGG + Intronic
1133266287 16:4586290-4586312 GGGTGTCAACAGAAGTGAATGGG - Intronic
1134450349 16:14359573-14359595 GGGTAGGCAGAGAAGTAGAGAGG - Intergenic
1134467109 16:14489188-14489210 GGGAATCAGGAGAACTAGAGAGG + Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1135358494 16:21790885-21790907 GGGTATAAATGGAAGAAGAGAGG + Intergenic
1135456996 16:22607010-22607032 GGGTATAAATGGAAGAAGAGAGG + Intergenic
1135984736 16:27175821-27175843 GGGCTTCCACAGAAGAAGAGGGG - Intergenic
1140301404 16:73761011-73761033 GGGTATTAAAAGAGGAAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141222173 16:82081302-82081324 GAGTGACAACAGAAGGAGAGAGG - Intronic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1144953502 17:19005953-19005975 GGGGATCCACAGTAGCAGAGGGG - Intronic
1145097332 17:20042198-20042220 GGGTGTCAATGGAAGCAGAGCGG - Intronic
1145344477 17:21980216-21980238 TGGAATCAACAGGAATAGAGTGG + Intergenic
1147236124 17:39058874-39058896 GGGTGTCAGCAGCTGTAGAGAGG + Intergenic
1149667026 17:58372088-58372110 AGACATCAACAGTAGTAGAGGGG - Intronic
1150196653 17:63305790-63305812 TGGTATGAAGAGAAGAAGAGGGG + Intronic
1150272742 17:63876980-63877002 TGGGGTCAACAGAAGTGGAGAGG - Intronic
1150274083 17:63884739-63884761 TGGGGTCAACAGAAGTGGAGAGG - Intergenic
1150278396 17:63914273-63914295 TGGGGTCAACAGAAGTGGAGAGG - Intronic
1151225012 17:72641276-72641298 CGGTATGATGAGAAGTAGAGAGG - Intergenic
1156902452 18:42316206-42316228 AGGTGTCAACAGAGGTTGAGTGG + Intergenic
1157392740 18:47316566-47316588 GAGTATCCAGAGAAGTGGAGTGG - Intergenic
1159263226 18:66043678-66043700 GGGGAAAAGCAGAAGTAGAGTGG - Intergenic
1167310238 19:48733399-48733421 GGGTACCAACAGAACTTGATTGG - Intronic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
927223257 2:20735763-20735785 GGGTGTCAACAGAAGTCAAATGG - Intronic
927917266 2:26945225-26945247 GGGTAGCAGAAGGAGTAGAGAGG - Intronic
928354475 2:30597607-30597629 GGGTATCTACATAGGAAGAGAGG - Intronic
928944096 2:36756675-36756697 GGGTATCAACCGCAGTACTGTGG + Intronic
930155173 2:48099289-48099311 GAGTATCAACAGAGGTTGAGTGG + Intergenic
932061461 2:68503983-68504005 CAGTATCAACAGTAGAAGAGGGG + Intronic
934177892 2:89593322-89593344 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
934288191 2:91667623-91667645 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
937241153 2:120463499-120463521 GGGTATGAACAGACATAGATGGG - Intergenic
939518223 2:143196193-143196215 GGGGAAGAACAGAAGTAGAAAGG + Intronic
940146432 2:150549721-150549743 GGGTATGAACCCAAGTAGTGAGG + Intergenic
943066492 2:183091954-183091976 GACTATCCACAGTAGTAGAGGGG - Intronic
943163142 2:184281200-184281222 GGGTATTCACATAAGAAGAGGGG - Intergenic
945359373 2:208878772-208878794 GGGGGTCAACAGAAGCTGAGTGG - Intergenic
946007541 2:216538480-216538502 GGAAATCACCAGAAGTATAGAGG - Intronic
946511046 2:220356784-220356806 GGGTAGGAAAAGAAGGAGAGTGG + Intergenic
947144068 2:227048191-227048213 GGGTTTCAAGAGAATTACAGAGG + Intronic
948130974 2:235600415-235600437 GGGTATCTACAGGAGTATGGGGG - Intronic
1168979780 20:1994533-1994555 GGGTAGAAACACAAGGAGAGAGG + Intergenic
1169845498 20:9987438-9987460 GTTTATGCACAGAAGTAGAGAGG + Intronic
1171915118 20:31056901-31056923 GGGAATCAACAAAAGTGGAAAGG + Intergenic
1174102080 20:48135360-48135382 GGTTATGAACAGAAGCAGAATGG + Intergenic
1182893930 22:33843487-33843509 AGGTCTCAACAGAGGTAGACAGG + Intronic
1184397869 22:44255472-44255494 GGGTATGAAAGGAAGAAGAGGGG - Intronic
951940139 3:28068918-28068940 GGGTACCAACATGGGTAGAGTGG + Intergenic
960816672 3:121680148-121680170 GGGTATCAACGAAAGTTGAATGG + Intronic
961107317 3:124253104-124253126 GGCAATCAGCAGAAGTACAGAGG + Intronic
961517852 3:127449562-127449584 GGTTTTAAACAGAACTAGAGAGG - Intergenic
962963700 3:140334718-140334740 GGGGGGCAACAGAAGTGGAGCGG + Intronic
967865402 3:194186173-194186195 GGTTATGATCAGAAGTGGAGAGG + Intergenic
969322481 4:6421062-6421084 GGGTGTCCACAGAAGTGGAGAGG + Intronic
969831353 4:9800072-9800094 AGGTATAAAAAGAAATAGAGAGG + Intronic
970593716 4:17580604-17580626 GGGAGTTAAAAGAAGTAGAGAGG - Intronic
971220504 4:24701251-24701273 GGGTAAGAACTGAAGTAGAGAGG + Intergenic
973104823 4:46322406-46322428 GGGTGGCTAGAGAAGTAGAGAGG - Intronic
973707725 4:53596808-53596830 GTGACTCAATAGAAGTAGAGGGG - Intronic
975728074 4:77311602-77311624 AGGTTTCAACAGAGGTAGACTGG + Intronic
980021750 4:127718948-127718970 GGGTATTCAAAGAAGAAGAGAGG - Exonic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
984816961 4:183847947-183847969 TGGTATAAAGAGAACTAGAGAGG + Intergenic
989153940 5:38326331-38326353 GAGCAGCAACCGAAGTAGAGAGG + Intronic
993186698 5:84630910-84630932 AGTTATCTACAGAACTAGAGGGG - Intergenic
993604706 5:89974761-89974783 GGGACTCAAGAGAAGTAGGGAGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994160689 5:96553581-96553603 AGGTATTCAAAGAAGTAGAGAGG + Intronic
994266942 5:97728406-97728428 GAGTACCAACAGAAATAGATAGG - Intergenic
994404413 5:99326087-99326109 GGGAATACACAGAAATAGAGAGG + Intergenic
995315057 5:110760271-110760293 AGGTGGCAACAGAAGTAAAGTGG - Intronic
995662178 5:114497454-114497476 TGGTATCAAATGAAGTGGAGGGG - Intergenic
996036633 5:118765588-118765610 GGGTATTCACATAGGTAGAGGGG + Intergenic
999261304 5:150240548-150240570 CGGTACCAAGAGAAGGAGAGGGG + Intronic
1000539717 5:162525353-162525375 GGGTGTCAACAGTAGTGGACTGG + Intergenic
1003103031 6:3191987-3192009 GGGTAAAAACAGAAGCATAGAGG + Intergenic
1003222159 6:4170564-4170586 GGGAATCCACACAAGCAGAGTGG + Intergenic
1012067023 6:94560402-94560424 GGGTATCAACAGAGGTAGAGTGG + Intergenic
1013445248 6:110219692-110219714 AGGTAAAGACAGAAGTAGAGTGG - Intronic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1020962124 7:14818480-14818502 GGGTACCTGCAGAAGTATAGTGG - Intronic
1022549964 7:31228995-31229017 AGGTACCAACAGAGGTAGACTGG + Intergenic
1024799516 7:53059799-53059821 GGGGATCACCAGAAGCCGAGGGG - Intergenic
1024886764 7:54151095-54151117 GGGTTTTAACAGAAGTAAACTGG - Intergenic
1029025033 7:97407301-97407323 GGGAAAGAACAGAAGAAGAGAGG + Intergenic
1032360206 7:131248362-131248384 GGGTACCAGCAGAGATAGAGGGG - Intronic
1034845800 7:154443373-154443395 TGTTATCAACAGAAGTTGAATGG - Intronic
1035164852 7:156980977-156980999 AGGGAGCAACAGGAGTAGAGTGG - Intergenic
1035586979 8:784358-784380 GGGTATAGACAGAAAAAGAGAGG + Intergenic
1039668845 8:39572087-39572109 AAGTATCAAGAGAATTAGAGAGG - Intergenic
1039816752 8:41101091-41101113 GGCTACGAGCAGAAGTAGAGAGG - Intergenic
1042689532 8:71482872-71482894 GGGTATCAGCTGAAAGAGAGGGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1047794618 8:128241921-128241943 GGGGATAAAGAGATGTAGAGTGG + Intergenic
1048083062 8:131149384-131149406 GGTTAAAAACACAAGTAGAGAGG + Intergenic
1048139487 8:131779553-131779575 TAATAGCAACAGAAGTAGAGAGG - Intergenic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1052643507 9:31200703-31200725 GGGTATCAACAGAGGCTGAGGGG + Intergenic
1057320488 9:94007982-94008004 GGGTGTCAACAGAAGCCGAGGGG + Intergenic
1057856522 9:98605147-98605169 AGGCCTCAACAGAAGGAGAGGGG - Intronic
1188710224 X:33387727-33387749 GGCTAAAAACAGAAGTGGAGAGG + Intergenic
1191981661 X:66932280-66932302 GGGTACCAACAGAAATATAATGG - Intergenic
1192146320 X:68685347-68685369 GGCCACCAACAGAAGTAGAATGG + Intronic
1194284292 X:91990677-91990699 GTGTGTTAACAGAAGTTGAGTGG - Intronic
1194897429 X:99461581-99461603 GGGCATCAAGAGAAGTAGGAAGG + Intergenic
1195026087 X:100879027-100879049 GGGTATTCAGAGAAGTAAAGAGG + Intergenic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1200601860 Y:5215236-5215258 GTGTGTTAACAGAAGTTGAGTGG - Intronic
1201097410 Y:10631945-10631967 TGGAATCAAAAGAAGTAGAGTGG - Intergenic
1201133315 Y:10971731-10971753 TGGAATGAACAGCAGTAGAGAGG - Intergenic
1201134239 Y:10978332-10978354 TGGAATCAACAGGAGTGGAGTGG - Intergenic