ID: 1100421208

View in Genome Browser
Species Human (GRCh38)
Location 12:94435677-94435699
Sequence CTGAAATGGCTTGAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 31, 2: 85, 3: 98, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100421208_1100421212 9 Left 1100421208 12:94435677-94435699 CCAACCAACTCAAGCCATTTCAG 0: 1
1: 31
2: 85
3: 98
4: 228
Right 1100421212 12:94435709-94435731 ACAGAACAACTCTGTTCCAACGG 0: 1
1: 1
2: 4
3: 26
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100421208 Original CRISPR CTGAAATGGCTTGAGTTGGT TGG (reversed) Intronic
900492159 1:2955795-2955817 TAGAAATGGCTTGAGTGGCTGGG + Intergenic
900617050 1:3570226-3570248 CTGAAGTGGGTTGAGTGGGTGGG - Intronic
905702361 1:40027056-40027078 ATAAAAGGGCTTGAGTTGGTGGG + Intergenic
906409257 1:45565987-45566009 CTGAGATGGCTTGGGTAGGAAGG + Intronic
906962326 1:50426135-50426157 CTGATTTGGATTGGGTTGGTCGG + Intergenic
907633395 1:56107130-56107152 CTGTAATGGCTTGAGTTAGTTGG - Intergenic
907647043 1:56254592-56254614 CCCAAATGGCTTGAGTAGTTGGG + Intergenic
907887438 1:58606568-58606590 CTGTAATAACCTGAGTTGGTTGG + Intergenic
907892795 1:58651366-58651388 TTGAAATGGGTTGAGTGGCTAGG + Intergenic
908627138 1:66057924-66057946 CTGAAATGGGTTGACTTTGGGGG - Intronic
912567808 1:110601036-110601058 CTGAAATGGCTTCAGGTAGGGGG - Intronic
912612413 1:111061982-111062004 CTGTAATGGCTTGAGTAGGTTGG + Intergenic
913036499 1:114971015-114971037 CTGTAATGCCTTGAGTTGGTTGG + Intronic
913155420 1:116092433-116092455 CTATAATGGATTGCGTTGGTTGG + Intergenic
915670135 1:157482121-157482143 CAGAAATGTCTTTAATTGGTTGG + Intergenic
915999889 1:160605776-160605798 CTATAATGGCTTGACTTGATTGG + Intergenic
916299497 1:163258028-163258050 CTGAGAGGGCCTGAGCTGGTGGG - Intronic
918171800 1:182004429-182004451 CTGTAATGGTTTGTGTTGGTTGG - Intergenic
921116619 1:212098329-212098351 CTGTAATGGCTTGAATTGGTTGG + Intronic
921788536 1:219262939-219262961 CTGTAATGGTTTGAGTTGGTTGG + Intergenic
922038861 1:221876146-221876168 CAGAAATGCCTTGTTTTGGTTGG - Intergenic
923122297 1:231003001-231003023 CTATAATGGCCTGAGTTGGTTGG - Intergenic
923174079 1:231446230-231446252 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
923691890 1:236202348-236202370 CTGTAATGTCCTGAGGTGGTTGG + Intronic
924119198 1:240779230-240779252 CTCAAATTGCTTGAGTTGCTGGG + Intronic
924768058 1:247052702-247052724 CTATAATGGCTTGCGTTGGTTGG + Intronic
1065355265 10:24834544-24834566 CTGTAATGGACTGTGTTGGTAGG - Intergenic
1065809781 10:29430673-29430695 CTGAAATGTCAAGAGTTGGGGGG + Intergenic
1065809805 10:29430936-29430958 CTGAAATGTCAAGAGTTGGGGGG + Intergenic
1066019470 10:31283624-31283646 GTGAAATGGTTTGAGTCAGTTGG + Intergenic
1066544611 10:36485806-36485828 CTGAAATTGCTTTATTTGGCTGG - Intergenic
1067993235 10:51239682-51239704 ATGAAATGGTTTGAGTACGTGGG + Intronic
1068532962 10:58209849-58209871 CTGTAATGGCCTGAGTTGGTTGG + Intronic
1068556505 10:58464931-58464953 CTATAATGGCCTGAGTTGGTTGG + Intergenic
1069146324 10:64896325-64896347 CTGTAATGTCCTGAGTTGGTTGG + Intergenic
1071062653 10:81591078-81591100 CTGTAATGTCCTAAGTTGGTTGG - Intergenic
1071666322 10:87562332-87562354 ATGAAAGGACTTGAGCTGGTGGG - Intergenic
1072780867 10:98250760-98250782 CTGACATGGCTTGAGGTGACAGG + Intronic
1073741685 10:106414772-106414794 CTGTGATGGCCTGAGTTGGTTGG - Intergenic
1074466952 10:113691967-113691989 CTGTAATGGACTGTGTTGGTTGG + Exonic
1075070201 10:119315276-119315298 CTGAAAAGGCTTGAGTCACTCGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075354150 10:121755952-121755974 CTGAAATGAGTTGAGATGTTGGG - Intronic
1077853296 11:6096422-6096444 CTGTAATGGACTGTGTTGGTTGG - Intergenic
1077956419 11:7025086-7025108 CTGAAATGTCATGAGTTATTTGG - Intronic
1078687816 11:13549447-13549469 CTGTAATGGCCTGAGTTGGTTGG + Intergenic
1078991283 11:16648564-16648586 TTGTAATGGCCTGAGCTGGTTGG - Intronic
1079415797 11:20235350-20235372 CTGTAATGGCTTGAGTTAGTTGG - Intergenic
1079464139 11:20713074-20713096 CTTTAATGGCCTGAGTTGGTTGG + Intronic
1079633945 11:22712086-22712108 CTGTAATGACTTGAGTTGGTTGG - Intronic
1080567627 11:33526209-33526231 CTGTAATGGCTTGAATTGGTTGG - Intergenic
1080646206 11:34189790-34189812 CTGAGAAGGCTGGAGTAGGTGGG - Intronic
1081294746 11:41371739-41371761 TTGAAAGGGCTGGAGTAGGTAGG - Intronic
1082934989 11:58647051-58647073 CTGTAATGGCTTGAGTTTGTTGG + Intronic
1083068147 11:59946633-59946655 CTGAAATAACTTGATTTGGTTGG - Intergenic
1086864224 11:91960143-91960165 TTGTTTTGGCTTGAGTTGGTTGG - Intergenic
1086869322 11:92018044-92018066 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1087395341 11:97589607-97589629 CTGCAGTGGCCTCAGTTGGTTGG - Intergenic
1087630845 11:100648338-100648360 CTGTAATGGCTTGAGTTGTTTGG - Intergenic
1087640884 11:100752886-100752908 CTGTAATGGTCTGTGTTGGTTGG + Intronic
1088145257 11:106669254-106669276 CAGAAATGGGGAGAGTTGGTGGG + Intergenic
1088413709 11:109566646-109566668 CTATAATGGTTTGTGTTGGTTGG + Intergenic
1090756739 11:129798327-129798349 CTGTGGTGGCCTGAGTTGGTTGG - Intergenic
1091380833 12:57459-57481 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
1092255649 12:6925596-6925618 CTGAAGTCCCTTGAATTGGTTGG - Intronic
1092604297 12:10101786-10101808 CTGCAATGGACTGTGTTGGTAGG - Intronic
1092964893 12:13632031-13632053 TTCAAATGGCTTAAGTTGGAGGG - Intronic
1093469154 12:19482512-19482534 CTCTAATGGCCTGAATTGGTTGG + Intronic
1093838578 12:23867672-23867694 CTGAAATGAATTAAGTGGGTTGG + Intronic
1095725433 12:45446617-45446639 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
1096564108 12:52461894-52461916 CTGTACTGTCCTGAGTTGGTTGG - Intergenic
1096956407 12:55530230-55530252 TTGTAGTGGCTTGAGTTGGTTGG - Intergenic
1097912558 12:64986124-64986146 CTGAACTGGGTTCAGTAGGTAGG + Intergenic
1099112881 12:78584909-78584931 CTGAAATGGCTGCAGTTGTCAGG + Intergenic
1100421208 12:94435677-94435699 CTGAAATGGCTTGAGTTGGTTGG - Intronic
1100855937 12:98757269-98757291 CTGCAATGGCTGGAGATGCTGGG - Intronic
1100937085 12:99681225-99681247 CTGTAATGGCTTGAGTTGGTTGG - Intronic
1104535674 12:129615890-129615912 CAGAACTGGCTTGAGTTGAGTGG + Intronic
1105314244 13:19242773-19242795 CTGTAATAGCTTGAGTTGGTTGG - Intergenic
1105598834 13:21867054-21867076 CTGTAATGGTTTGAGTTGGTTGG + Intergenic
1106802954 13:33275093-33275115 CTGAACTGGCCTGAAATGGTGGG - Intronic
1107591139 13:41908032-41908054 CAGAAATGGCTATAGTTTGTGGG - Intronic
1107702000 13:43058188-43058210 CTATAATGGCTTGAGTTTGTTGG + Intronic
1109625030 13:64963023-64963045 CTGTAATGGCTTGAGTTTCTTGG - Intergenic
1110158011 13:72342091-72342113 CTGTAAAGGCTTGAGTTGATTGG + Intergenic
1111160907 13:84393929-84393951 CTGTAATGGCTTAAGTTGGTTGG + Intergenic
1111165024 13:84447478-84447500 CTGTAATGGACTGTGTTGGTTGG + Intergenic
1111283032 13:86051731-86051753 CTGTAATGGTTTGTGTTGGCTGG - Intergenic
1112253816 13:97809113-97809135 CTGAAATGGTTTGGGTGGGGTGG + Intergenic
1114694289 14:24612326-24612348 CTGTAATGGCCTGTGTTGTTTGG + Intergenic
1114756791 14:25269086-25269108 CTGTAATGGTCTGAGTTGGTTGG + Intergenic
1114760512 14:25308779-25308801 CTGTAATGACTAGAGTTGGTTGG - Intergenic
1115608074 14:35025429-35025451 CTGAAATAGCATGTGATGGTAGG - Intronic
1116114342 14:40629048-40629070 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1117193380 14:53316132-53316154 CTGTAATGTCCTGAGTTGGTTGG + Intergenic
1117240732 14:53829741-53829763 CTGTAATGGCCTCAATTGGTTGG - Intergenic
1117271347 14:54146749-54146771 CTGTAATGACTTGAGTTTGTTGG - Intergenic
1120605404 14:86570310-86570332 CTGTAATGACTTGAGTTGGTTGG + Intergenic
1121632940 14:95434052-95434074 CTGATATGGCTGGAGTTGGGTGG + Intronic
1121725779 14:96148805-96148827 TTGTAATGACCTGAGTTGGTTGG + Intergenic
1121749144 14:96332692-96332714 CTTAAAAGACTTGAATTGGTGGG - Intronic
1122298039 14:100716522-100716544 CTGTAATGGCCTTAGTGGGTGGG - Intergenic
1122486474 14:102085597-102085619 GTGTAATGGCATGACTTGGTGGG - Intronic
1123401115 15:19987812-19987834 GGGAAAGGGCTAGAGTTGGTAGG - Intergenic
1124409766 15:29427466-29427488 CCAAAATGGGTTGGGTTGGTAGG + Intronic
1126330941 15:47530696-47530718 CTTAAATCACTTGAGTTTGTAGG + Intronic
1126997384 15:54460496-54460518 CTGTAATGGCTGGAGTTGGTTGG + Intronic
1127092471 15:55480636-55480658 CTGAAAGGGTATGAGTTGGGTGG - Intronic
1127574038 15:60272902-60272924 CTGTAATGGTTTGTGTTAGTTGG + Intergenic
1127736034 15:61840117-61840139 CTGAATTGGCAGGAGATGGTGGG - Intergenic
1127911844 15:63422704-63422726 ATTAAATGGCTTGAGTTGACAGG + Intergenic
1129094397 15:73188007-73188029 CTGATATGTCTGGATTTGGTAGG - Intronic
1130833196 15:87624001-87624023 CTGTAATGACTTGAGTTTGTTGG + Intergenic
1136566848 16:31075659-31075681 CTGAAATGACTCGGGGTGGTGGG + Intronic
1137049248 16:35694047-35694069 TTAAAATGGCTGGGGTTGGTGGG + Intergenic
1138727303 16:59153886-59153908 CTGAAATAAATAGAGTTGGTAGG + Intergenic
1142940398 17:3376201-3376223 CTGTAATGGCTTTAGATTGTTGG + Intergenic
1145167367 17:20624743-20624765 CTGTAATGACCTGAGTTGGTTGG - Intergenic
1146954516 17:36929551-36929573 AAGAAATGGCTTGGGTTGGGGGG + Intergenic
1147892305 17:43726016-43726038 CTCAAATGGCTAGAGGTGGCTGG - Intergenic
1149311540 17:55399047-55399069 CTGACATGGCTGCAGTTTGTGGG - Intronic
1150896116 17:69213136-69213158 GTGTAATGGCTTGAGTTCATTGG + Intronic
1150947547 17:69765094-69765116 CTTTAATGGCTGGAGTTGGCTGG + Intergenic
1153425033 18:4953266-4953288 CTCTAATTGCTTGAGTTGATTGG - Intergenic
1153851093 18:9095248-9095270 CTGAGATAGCCTGACTTGGTGGG - Intergenic
1155886771 18:31217644-31217666 CTGCAATGGCTTGATTTGTTTGG - Intergenic
1156020945 18:32598341-32598363 CTGTAACGGCTTGAATTGGTTGG - Intergenic
1156216827 18:35007641-35007663 CAGAGATGGGTTAAGTTGGTAGG + Intronic
1156326707 18:36079975-36079997 CTGTAACGTCCTGAGTTGGTTGG - Intergenic
1156344722 18:36246767-36246789 CTGTAATGGCTTGAGTTGATTGG + Intronic
1156633322 18:38996225-38996247 CTGTATTGGCCTGAGTTGGCTGG + Intergenic
1157420710 18:47545664-47545686 CTCAAATCGCTTGGGTGGGTGGG - Intergenic
1158115484 18:53990829-53990851 CTGAAAGGGCTTGAGTTGTTGGG + Intergenic
1158492556 18:57923357-57923379 TAGAAATGGCTTGTGATGGTTGG + Intergenic
1158628716 18:59093573-59093595 CTCAAATGGCTGGAGGTGGCTGG + Intergenic
1158868520 18:61661397-61661419 CTGAAATCTATTGAGTTGTTGGG - Intergenic
1160058691 18:75509969-75509991 CTGTAATGGCCTGAGGTGTTTGG - Intergenic
1162293853 19:9799322-9799344 CTGAAATGGTTTAAGTGAGTTGG - Intergenic
1163886616 19:19971155-19971177 CTGTAAGGGCTTGAGTTGGTTGG + Intergenic
1163967881 19:20764968-20764990 ATGTAATGGCTTGAGTTGGTTGG - Intronic
1167683720 19:50942331-50942353 AGGAAATGTCGTGAGTTGGTGGG - Intergenic
1168323709 19:55526118-55526140 CTGAAATAGCCTGAGCTGTTAGG - Intergenic
1168349339 19:55667170-55667192 CTGGAAGGGCTTGAGTGAGTAGG + Intronic
925688006 2:6492791-6492813 CTGTTATGGCCTGAGTTGATTGG - Intergenic
927437164 2:23076623-23076645 CTGAAGTGGCTTCAGTTGTTTGG - Intergenic
928472966 2:31592237-31592259 CTGTAATGGCTTGAGTTGGATGG - Intergenic
929125040 2:38515655-38515677 CTGAAATGGCTTGTCATGGTAGG + Intergenic
930159987 2:48145009-48145031 TTGTAATGGCCTGAGTTGGTTGG + Intergenic
930574269 2:53127179-53127201 CTGTAATGGCTTTAGTTGGTTGG + Intergenic
933086389 2:78059264-78059286 CTGTAATGGCAAGAGTTGGTTGG + Intergenic
933341035 2:81026270-81026292 CTATAATGGCCTGAGTTGGTTGG + Intergenic
933474414 2:82771025-82771047 CTGTAATGTCTTAAGTTGGTTGG - Intergenic
934111373 2:88746862-88746884 CTGTAGTGGCTTGAGTTGGTTGG + Intronic
935074004 2:99722842-99722864 CTGTAATGGCTTGAGGTGTCAGG - Intronic
936140878 2:109938982-109939004 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
936177569 2:110236927-110236949 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
936203815 2:110432504-110432526 CTGTAATGGCTTGAGTTGGTTGG + Intronic
936633861 2:114233956-114233978 CTGTAATGGCTTGACTTGGTTGG + Intergenic
936857735 2:116980413-116980435 CTGTAATGACTTGAGTTGGTTGG - Intergenic
937410476 2:121670373-121670395 CTGTCATATCTTGAGTTGGTTGG - Intergenic
938599468 2:132822096-132822118 CTGTAATGGCCTGAGTTTGTTGG - Intronic
938854836 2:135298920-135298942 CTGTAATGGCTTGAGTTGGCTGG + Intronic
938900207 2:135793007-135793029 CTATAATGGCGTGAGTTGGTTGG - Intronic
939745024 2:145957754-145957776 TTATAATGGCTTGAGTTGGTTGG + Intergenic
939919179 2:148087261-148087283 CTATAATGTCCTGAGTTGGTTGG - Intronic
940307291 2:152240158-152240180 CTGAGATGGCTTGAATAGCTGGG + Intergenic
940366199 2:152851705-152851727 CTGTAATGGACTGTGTTGGTTGG + Intergenic
941402154 2:165044611-165044633 CTGTAATGGTTTGAATTGGTTGG + Intergenic
942743655 2:179207273-179207295 CTGTAATGGCTTGACTTGGTTGG - Intronic
943393052 2:187294784-187294806 CTGAAGTGTCTGGAATTGGTGGG + Intergenic
943607817 2:189997196-189997218 CTGTAATGTCCTGAGTTGGTTGG + Intronic
943884858 2:193203715-193203737 ATGAAATGGCTTATGTTGATTGG - Intergenic
944263718 2:197701522-197701544 CTGTAATGTCCTGAGTTGGTTGG + Intronic
944602840 2:201320916-201320938 CTGTAATGGACTGTGTTGGTTGG - Intronic
945739213 2:213640849-213640871 CTGTAATGGCTTGAGTTGGTTGG + Intronic
945914399 2:215687593-215687615 CTGAAATGGATTTTGTTGGAGGG + Intergenic
946081458 2:217123238-217123260 CTGAAATAGACTGAGTCGGTGGG + Intergenic
947997373 2:234539752-234539774 CTGAAAGGCCTGGAGGTGGTGGG + Intergenic
948373333 2:237504557-237504579 CTGAAATGGCAGCAGTTGGACGG + Intronic
1170667285 20:18397697-18397719 CTCAAATGGCTAGAGGTGGTTGG + Intronic
1170865356 20:20150441-20150463 CTGTAATGTCCTGAGTTGGTTGG - Intronic
1171003208 20:21435784-21435806 CTCAAATGGCTTGAGAGGGCAGG + Intergenic
1171198501 20:23222710-23222732 CTGTAAAGACCTGAGTTGGTTGG + Intergenic
1173927329 20:46790637-46790659 CTGAATTGGCTTGATTGGCTTGG - Intergenic
1175477501 20:59287331-59287353 CTGTAATGAGTTGAGCTGGTGGG + Intergenic
1175547699 20:59789269-59789291 CTGAAACAGCTGGAGTTTGTAGG + Intronic
1175815442 20:61881017-61881039 AGGAAGTGGCCTGAGTTGGTTGG - Intronic
1176049297 20:63108141-63108163 CTGAAATGAGTGGAGTTGCTTGG - Intergenic
1176658653 21:9613314-9613336 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1176746806 21:10659449-10659471 TTGAAATGACTTGAGTACGTTGG - Intergenic
1177364503 21:20117011-20117033 TCATAATGGCTTGAGTTGGTTGG + Intergenic
1177657302 21:24035254-24035276 CTGTAATGTCCTGAGTTGGCTGG - Intergenic
1177982601 21:27932891-27932913 CTGTAGTTGCTTGAGCTGGTTGG + Intergenic
1179443369 21:41411586-41411608 CTGTAATGGCTTGAGTGGGTTGG - Intergenic
1181873219 22:25919731-25919753 CTGAAATGTATTGTTTTGGTAGG - Intronic
1183178648 22:36243773-36243795 CTGTAATGGCCTGAGTTGGTTGG + Intergenic
1184065482 22:42117074-42117096 CTGTAATGTCCTGACTTGGTTGG + Intergenic
949146007 3:700951-700973 CAATAATGGCTTGAGTTGGTTGG + Intergenic
950424583 3:12918199-12918221 CTGAAAAGGGGTGACTTGGTGGG + Intronic
951260609 3:20503799-20503821 CTGTAATGAGCTGAGTTGGTTGG + Intergenic
951325901 3:21301545-21301567 CTGAAATGGCTTGAGTTTGTTGG - Intergenic
951467802 3:23020708-23020730 CTGTAATGGCTTGAGTTGACTGG - Intergenic
951607197 3:24449008-24449030 CAGGAATGGCTTGAGTTTGAAGG + Intronic
951727255 3:25774219-25774241 CTGTAATGGTTTCAGTTGGTTGG + Intronic
952122746 3:30264147-30264169 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
952183188 3:30941345-30941367 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
953181811 3:40602660-40602682 CTCAAATGGTTGGAGATGGTGGG + Intergenic
953195736 3:40731624-40731646 CTGTAATGTCTTGAGTTGGTTGG + Intergenic
954257587 3:49417368-49417390 CTGGAATGGCATGAGTTAGGTGG + Exonic
955445694 3:59007423-59007445 CTGTAATGGCTTGAGTTGGTTGG - Intronic
955600431 3:60639529-60639551 CTCAAAAGGCTTGAATTGTTAGG + Intronic
955619783 3:60850464-60850486 ATGTAATGGAGTGAGTTGGTGGG - Intronic
956700176 3:71951931-71951953 AAGAGATGGCTTGGGTTGGTTGG - Intergenic
957281340 3:78154729-78154751 CTGTAATGGACTGTGTTGGTTGG - Intergenic
957392741 3:79598798-79598820 CTGCAATGGCCTGAGTTTGTTGG - Intronic
957681401 3:83440294-83440316 CTGTGATGGCCTGAGTTGGTTGG - Intergenic
957776267 3:84759885-84759907 CTGTGATGGCTTGTGTTGGTTGG - Intergenic
958510154 3:95037594-95037616 CTATAATGGCCTGAGTTGATTGG + Intergenic
958790359 3:98644748-98644770 CTGTAATGTCATGAGTTGGTTGG + Intergenic
959447350 3:106456769-106456791 CTGAAATGACTGGAGATGATTGG - Intergenic
960577997 3:119245947-119245969 CTGTAATGGCCTGAGTTGGCTGG - Intergenic
960712420 3:120544756-120544778 CTGTAATGGCCTGAGTTGGTTGG + Intergenic
960822530 3:121749667-121749689 CTGACGTGGCTTGAATTGGGAGG - Exonic
961401877 3:126652782-126652804 CTGAAATGGAGTAAGTGGGTTGG + Intronic
962191900 3:133319417-133319439 CCGTAATGTCCTGAGTTGGTTGG - Intronic
962673707 3:137736058-137736080 TTGTAATGTTTTGAGTTGGTTGG + Intergenic
962862143 3:139414321-139414343 CTGTAATGGCCTGAATTGGTTGG + Intergenic
963023558 3:140896958-140896980 CTGTAATGTCCTGACTTGGTTGG + Intergenic
963051020 3:141143720-141143742 CTGTAATGTCCTGAGTTGGTTGG + Intronic
963286473 3:143438841-143438863 CTGACATTCCTGGAGTTGGTGGG - Intronic
964457648 3:156885868-156885890 CTGTAATGGCTTAAGTTGGTTGG + Intronic
965015590 3:163153244-163153266 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
965184974 3:165451591-165451613 CTGTAATGTCCTGAGTTGGTTGG - Intergenic
965345185 3:167540079-167540101 CTGTAATGTCCTGAGTTTGTTGG - Intronic
966092774 3:176159954-176159976 CTATAATATCTTGAGTTGGTTGG - Intergenic
966553377 3:181230423-181230445 CCGTAATGTCCTGAGTTGGTTGG + Intergenic
967246442 3:187491570-187491592 CTATAATGGCCTGAGTTGTTTGG - Intergenic
967958660 3:194900781-194900803 CTGTAATGTCTTGAGTTGGCTGG + Intergenic
968243144 3:197111288-197111310 GTGAACTAGGTTGAGTTGGTTGG + Intronic
969901450 4:10354350-10354372 CTGTAATTGCTTGAGTTGGTTGG + Intergenic
970215782 4:13758750-13758772 CTCTAATGGCTTAAGTTGGTTGG + Intergenic
970856195 4:20651523-20651545 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
970877341 4:20886371-20886393 CTGAAGTGGCTGGAATTTGTAGG + Intronic
973742313 4:53929990-53930012 CTGAAATGGGATGAGATGGAAGG - Intronic
974410660 4:61538108-61538130 TTGAAATGGCTTCAGTTGGATGG + Intronic
974472123 4:62331826-62331848 CTGTAATGGCTTAAGTTGGTTGG - Intergenic
974856274 4:67465472-67465494 CTGTAATGGACTGTGTTGGTTGG - Intergenic
975136679 4:70881615-70881637 CAGAAACGGCTTGCTTTGGTTGG - Intergenic
976562744 4:86521211-86521233 CTGTAATGTATTGAGTTGGTTGG + Intronic
977762802 4:100759431-100759453 CTGTAATGGCCTGAGTTGATTGG - Intronic
978343166 4:107738750-107738772 CTAAAGTGGCTTCAGTTGCTTGG + Intergenic
979357028 4:119716214-119716236 CTAAAATGGCTTGAGTTGGTTGG - Intergenic
979434646 4:120673918-120673940 ATGTAATGGCCTGTGTTGGTTGG - Intergenic
979584805 4:122403595-122403617 CTGTAATGGCTTGAGTTGATTGG + Intronic
980187015 4:129475193-129475215 CTGTAATGGCCTGAGTTCATTGG + Intergenic
980367163 4:131819163-131819185 CTGAAATGGATTGTGTCAGTAGG + Intergenic
980392050 4:132159484-132159506 CTGTAATGGCTTGAGTTGGTAGG + Intergenic
981442503 4:144799186-144799208 CTGTAATGGCTTGAGTTGATTGG + Intergenic
982800264 4:159697497-159697519 CCGTAATGACTTGAGTTGGTTGG + Intergenic
983202095 4:164872471-164872493 CTAAAATCACTTCAGTTGGTAGG + Intergenic
983546999 4:168975498-168975520 CTGTAGTGGCTTGAGTTCATTGG + Intronic
983661575 4:170134978-170135000 CTGTAATGGCCTGAGTTGGTTGG + Intergenic
983776163 4:171609873-171609895 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
983807914 4:172018121-172018143 CTGTAATGGCCTGAATTGGTAGG + Intronic
983845553 4:172514014-172514036 CTGTAATGGCTTGAGTTGGTTGG + Intronic
983939749 4:173526910-173526932 CTGGAAGGGGTTGAGTAGGTTGG + Exonic
983963047 4:173777939-173777961 CTCTGATGGTTTGAGTTGGTTGG + Intergenic
984220086 4:176964461-176964483 CTGAATATGCTTCAGTTGGTGGG + Intergenic
984441057 4:179771371-179771393 CTGGACTGGTTTGAATTGGTAGG - Intergenic
984562531 4:181287540-181287562 CTAAAATGGCTTGGGTTGGGAGG - Intergenic
985416753 4:189742753-189742775 CTGTAATGGCTTCAGTTGGTTGG - Intergenic
986885396 5:12227513-12227535 CAGAAATGGCTAGGGTTGGATGG - Intergenic
988117479 5:26915625-26915647 CTGAAATGTCTGGAGTCGGTAGG - Exonic
988278496 5:29114078-29114100 CTGTTATGGTTTGAGTTGGTTGG + Intergenic
988652353 5:33166685-33166707 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
988875807 5:35444440-35444462 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
990610474 5:57451983-57452005 ATGGAATGGCTAGAGTTGATTGG + Intergenic
991214785 5:64149454-64149476 CTGTAAAGGCCTGAGTTGGTTGG + Intergenic
991924406 5:71690320-71690342 CTGAAAAGGCTTTAGTCTGTAGG + Intergenic
992267436 5:75032964-75032986 CAGAAATGGCTAGAATTGGAAGG + Intergenic
993366005 5:87035130-87035152 CTATAATGGCTTGAGTTGGTTGG + Intergenic
993606766 5:90000558-90000580 CTGTAGTGGCTTGAGTTAGTTGG - Intergenic
993613745 5:90084978-90085000 CTGTAGTGGCTTGAGTTGGTTGG - Intergenic
994358019 5:98816809-98816831 CTGTAATGGGCTGAGTTGGTTGG - Intergenic
994778120 5:104061416-104061438 CTGTAATGACTTGAGTTGGTTGG + Intergenic
994887485 5:105582957-105582979 CTGTAATGGCTTGAGTTAGTTGG - Intergenic
995449583 5:112285962-112285984 ATGGAATGGCTTCAGTTCGTTGG - Intronic
996141301 5:119913113-119913135 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
996306994 5:122058876-122058898 CTGAAATAATTTTAGTTGGTTGG - Intronic
996326948 5:122286225-122286247 CTGTAATGGTTTGAGTTGGTTGG + Intergenic
996631890 5:125642821-125642843 CTGTAATGTCCTGAATTGGTTGG - Intergenic
998312464 5:141148951-141148973 CTGAAATGAATTGAATTGTTTGG + Intronic
998642147 5:144022990-144023012 CTAAAATGGCTTGAGGGGGTGGG + Intergenic
998741674 5:145210203-145210225 CTGAAATGTCCTGAGTTGGTTGG - Intergenic
999108664 5:149095679-149095701 CTGTAATGGCTTGAGTTGATTGG - Intergenic
999201387 5:149818992-149819014 CAGAAATAGCCTGAGTTGGGGGG - Intronic
999930930 5:156432370-156432392 CTGTAAAGGCCTGAGTTGGTTGG + Intronic
1000070897 5:157740249-157740271 CTGAAATGTCTTGAGTACATGGG - Exonic
1000237585 5:159376793-159376815 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
1005259429 6:24042449-24042471 CTGTAATAGCCTGAGTTAGTTGG + Intergenic
1006115622 6:31774682-31774704 CTGAAAAGGTTTGGGTGGGTGGG - Intronic
1006286362 6:33097403-33097425 TTGTAATGTCCTGAGTTGGTTGG - Intergenic
1007349525 6:41258777-41258799 CTGTGATGGCTTGTGTTGGTTGG - Intergenic
1008185843 6:48389323-48389345 CTGTAATTGCCTGAGTTGGTTGG + Intergenic
1008250884 6:49238343-49238365 CTGTAACAGCTTGAGTTGGTTGG + Intergenic
1009360247 6:62802780-62802802 ATGTAATGGCTTGAGTTGATTGG + Intergenic
1009644377 6:66378360-66378382 CTGTAATGGCTTGATTTGGTTGG - Intergenic
1009728006 6:67559498-67559520 CTGGAATACCTGGAGTTGGTGGG + Intergenic
1010017540 6:71122313-71122335 CTGTAATGACCTGAGTTTGTTGG + Intergenic
1010358536 6:74965377-74965399 CTGTAATGGCTTGAATTGGTTGG + Intergenic
1010801834 6:80186010-80186032 CTGTTATGTCTTGAGTTGGTTGG + Intronic
1010879451 6:81150058-81150080 CAGTAATGGCCTGAGTTGCTTGG - Intergenic
1011564276 6:88658134-88658156 CTGTAATGGCTTGAGTTGGCTGG - Intronic
1011588994 6:88952500-88952522 CTGTAATGGCCTGAGTTAGTTGG - Intronic
1012237426 6:96835677-96835699 CAGAAAATGCTTGAGATGGTGGG + Intronic
1012273532 6:97244170-97244192 CCGTAATGGCTTGAGTTGGTTGG + Intronic
1012696519 6:102391198-102391220 CTGTAATGGCCTGTGTTGGTTGG - Intergenic
1012965663 6:105669940-105669962 CCGTAATGGCTTGAGTTGGTTGG - Intergenic
1013559399 6:111289762-111289784 TTGACTTGGCTTGACTTGGTAGG - Intergenic
1014278563 6:119416371-119416393 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1014420940 6:121245001-121245023 CTGTAATGGCCTGAGTTTGTTGG - Intronic
1014658106 6:124132493-124132515 CTGTAATGGCCTGAGTTGGTTGG - Intronic
1014792732 6:125693236-125693258 CTTTAATGACCTGAGTTGGTTGG + Intergenic
1015899898 6:138053504-138053526 CTGTAATGGCTTGAGTTAATTGG - Intergenic
1016017949 6:139205179-139205201 CTGTAATGCCCTGACTTGGTTGG - Intergenic
1016461497 6:144284637-144284659 CTGAGATGGGGTGAGTTGGAAGG + Intergenic
1016497070 6:144675561-144675583 CTGTCATAACTTGAGTTGGTTGG + Intronic
1016910097 6:149190379-149190401 CTGTAATGGTTTGTGTTGATTGG + Intergenic
1018021968 6:159769792-159769814 CTGAGATGGCTGGAGTTTGTGGG + Intronic
1018353501 6:162987965-162987987 CTGTAATGTCCTGAGTTGGTTGG + Intronic
1019305775 7:333708-333730 CTGAACTGGCTTGGGGGGGTGGG - Intergenic
1023086338 7:36573261-36573283 CCAAAATGGCCTGAGTTGGGAGG - Intronic
1023303358 7:38797696-38797718 CTGAAATTGCTTGTAGTGGTAGG - Intronic
1023413473 7:39910294-39910316 CTGAAATGGACTGTGTTGGTTGG - Intergenic
1023669684 7:42562163-42562185 CTGTAATGGCTTGAGTTGGTTGG - Intergenic
1024617892 7:51131096-51131118 CTGAAATTGCTAGTGATGGTTGG - Intronic
1025821161 7:64966018-64966040 CTTTAATGGCTTGAGATGTTGGG + Intergenic
1026299631 7:69086100-69086122 CTGAACTGGAATGAGTCGGTTGG - Intergenic
1026442445 7:70456200-70456222 CTTACATGGATGGAGTTGGTGGG - Intronic
1027468057 7:78539992-78540014 CTGTAATGGCTTGAGTTGGTTGG + Intronic
1027733279 7:81902846-81902868 CTGTAATGGCTTGGGTTGGTTGG + Intergenic
1028197172 7:87920496-87920518 CTGTAATGGCCTGAGTTGATTGG - Intergenic
1028348024 7:89807817-89807839 CTGTAATGGCCTGAGTTAGTTGG + Intergenic
1028401632 7:90431295-90431317 CTGTAATGGCTTGAGTTGGTTGG - Intronic
1028819570 7:95190628-95190650 CTGTAATGTCCTAAGTTGGTCGG + Intronic
1031675828 7:124610636-124610658 CTGTAATGGCTTGAATTGGTTGG - Intergenic
1031799359 7:126223337-126223359 CTGTAATGGCTTGAGATGGTTGG + Intergenic
1031990647 7:128196740-128196762 CTGAAATGGCTGGAATTTGAGGG - Intergenic
1032931558 7:136678151-136678173 CTGTAATGGCTTGAGTTGATTGG - Intergenic
1033401211 7:141027023-141027045 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1033462725 7:141562266-141562288 CGGTAATGTCCTGAGTTGGTTGG + Intronic
1033816680 7:145082537-145082559 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
1034019538 7:147626705-147626727 CTGTAATGGCCTGAGTTGGTTGG - Intronic
1034247841 7:149662538-149662560 CTGTAATGGCTTGAGTTAGTTGG + Intergenic
1034593264 7:152162662-152162684 CTGAGATGCCTGGAGTCGGTGGG + Exonic
1035136586 7:156709244-156709266 CTGTAATGGCCTGATGTGGTTGG - Intronic
1035170533 7:157015044-157015066 CTGAAGGGGCTGGGGTTGGTGGG - Intergenic
1035943628 8:3933464-3933486 CTGAAAGGGGTTGAGTGGGTGGG - Intronic
1037425673 8:18751761-18751783 CTGAAAAGGATTAAGTTGCTTGG + Intronic
1037426159 8:18757039-18757061 CTGAAAAGGATTAAGTTGCTTGG + Intronic
1039642406 8:39237964-39237986 CTGTAATGGCTTGAGTTGGCTGG - Intronic
1039811176 8:41049541-41049563 CTGTAGTGGCTTGAGTTGGTTGG - Intergenic
1040362832 8:46683914-46683936 CTGTAAAGGATTGTGTTGGTTGG + Intergenic
1040529325 8:48253700-48253722 CTGCAATGGCTTGAGTGGGTTGG + Intergenic
1041246942 8:55897069-55897091 CTGCAATGGAATGAGCTGGTTGG + Intronic
1042084159 8:65089311-65089333 CTGTAATGGCCTGAGCTGTTTGG - Intergenic
1042466680 8:69136271-69136293 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1042608023 8:70565845-70565867 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
1042728986 8:71910416-71910438 CTCTAATGGCTTGAGTTGGTTGG + Intronic
1042729175 8:71912214-71912236 CTCTAATGGCTTGAGTTGGTTGG + Intronic
1043537770 8:81225602-81225624 CTGTAATGACCTGGGTTGGTTGG + Intergenic
1043986290 8:86696251-86696273 CTGTAATGGCTTGAGTTGATTGG + Intronic
1045952287 8:107865636-107865658 CTGTAATGGCCTGGGTTGGTGGG + Intergenic
1047149134 8:122241183-122241205 CGGAAATGGCTGGAGTGGCTGGG - Intergenic
1047227296 8:122967748-122967770 CTGTAATGGCTTGAGTTGGTTGG + Intronic
1047592043 8:126336722-126336744 CTGTAATGACCTGAGTTCGTTGG - Intergenic
1047842418 8:128767291-128767313 CTGTAATGGCCTAAGTTGGTTGG - Intergenic
1048220880 8:132540958-132540980 CTGAAGAGGCTGGAGTTTGTGGG + Intergenic
1048249214 8:132845637-132845659 CGGAAATGTCTTGAGTATGTTGG + Intronic
1050133869 9:2441448-2441470 CTGTAATAGCCTGAGTTGGTTGG + Intergenic
1052307230 9:27024051-27024073 CTGTAATGGTTTGTGTTGGTTGG - Intronic
1053231693 9:36415914-36415936 CTGTAATGGCTTCAGTTGGTTGG + Intronic
1055958571 9:81797759-81797781 ATGTAATAGCTTTAGTTGGTAGG + Intergenic
1058342931 9:103920500-103920522 CTGTGATGGACTGAGTTGGTTGG - Intergenic
1058784529 9:108374348-108374370 CTTTAATGGCTTAAGTTGGTTGG + Intergenic
1059507187 9:114810149-114810171 CTGAAAGGGCATGTGTTGTTGGG - Intergenic
1203636380 Un_KI270750v1:116893-116915 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1188709052 X:33371616-33371638 CTGTAATGTTTTGGGTTGGTTGG + Intergenic
1188870444 X:35364933-35364955 CTGTAATGGACTGTGTTGGTTGG - Intergenic
1189663348 X:43327077-43327099 CTGTAATGGCCTGAGTTAGTTGG + Intergenic
1191148749 X:57197981-57198003 GTGTAATGGATTGAGTTTGTTGG + Intergenic
1191679551 X:63826635-63826657 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1191784498 X:64903310-64903332 CTGTAATGATCTGAGTTGGTTGG + Intergenic
1191858660 X:65648116-65648138 TTGAAATGGCTGGAGGGGGTGGG + Intronic
1192008998 X:67247947-67247969 CTGTAATGTCTTGAGCTGTTTGG - Intergenic
1192021988 X:67403547-67403569 CTGTAATGTCCTTAGTTGGTTGG + Intergenic
1192310064 X:70004123-70004145 CTGAAATGTCAGTAGTTGGTAGG + Intronic
1192853407 X:74981329-74981351 CTGTAATGGCGTGAGTTTGTTGG - Intergenic
1192895657 X:75440597-75440619 TTGTAATGGCTTGAGTTGGTTGG + Intronic
1192900077 X:75487066-75487088 CTGTAATGGCTTGAGTTGGCTGG - Intronic
1192905203 X:75544110-75544132 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1192930539 X:75801250-75801272 CTGTAATGGCCCAAGTTGGTTGG - Intergenic
1192944993 X:75957068-75957090 CTGTAATGACTTCAGTTGGTTGG + Intergenic
1193076656 X:77362883-77362905 CTGTAATGTCCTGAGTCGGTTGG + Intergenic
1193185580 X:78508049-78508071 CTGTAATGGCTTGAGTTGGCTGG - Intergenic
1193203123 X:78715430-78715452 CAGTAATGGCTTGAGTTGATTGG - Intergenic
1193255413 X:79342735-79342757 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
1193382688 X:80834182-80834204 TTGTAATGGCTTGAGTTGTTTGG - Intergenic
1193460964 X:81790592-81790614 CTGCAATGGACTGTGTTGGTTGG + Intergenic
1193590657 X:83384847-83384869 CTGTAATGGTTTATGTTGGTTGG - Intergenic
1193924136 X:87464616-87464638 CTGTAATGGCCTGAATTGGTTGG - Intergenic
1193954607 X:87844419-87844441 CTGTAATGGCCTGAGTTCATTGG + Intergenic
1194058441 X:89165865-89165887 CTGTAATGGGTTGAGTTGGTTGG - Intergenic
1194076391 X:89399912-89399934 CTATAATGGCTTGAGTTGGTTGG + Intergenic
1194103562 X:89738425-89738447 CTGAAATGGCCTGAGTTTGTTGG + Intergenic
1194143969 X:90241196-90241218 CTGTAATGGACTGTGTTGGTTGG - Intergenic
1194214399 X:91110715-91110737 CTGTAATGGCTTGAGTTGGTTGG + Intergenic
1194224866 X:91244412-91244434 CTGTAATGGCTTGAATTGATTGG + Intergenic
1194262729 X:91716919-91716941 CTGTAATGGCATGAGTTGGTTGG - Intergenic
1194278260 X:91913788-91913810 CTGTAATGGCCTGAGTTGGTTGG - Intronic
1194353789 X:92855787-92855809 CTGTAATGGCCTGAGTTGCTTGG - Intergenic
1194553828 X:95333106-95333128 CTGTAATAGTTTGTGTTGGTTGG - Intergenic
1194588371 X:95766227-95766249 CTGAAATGGCTCATGTTGTTAGG + Intergenic
1194815842 X:98440174-98440196 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
1194868269 X:99096462-99096484 CTGTAACGGCCTGAGTTGGTTGG + Intergenic
1195817342 X:108903103-108903125 CTGTAATGTCCTGAGTTGGTTGG - Intergenic
1196599460 X:117585148-117585170 CTGTAATGGACTGTGTTGGTTGG + Intergenic
1196977874 X:121180114-121180136 CTGTAATGGCCTGAGTTAGTTGG + Intergenic
1197472163 X:126877436-126877458 CTGTAATGGGCTGAATTGGTTGG + Intergenic
1197544324 X:127806259-127806281 CTGAATTGGATTAAGTTGGAGGG - Intergenic
1197603768 X:128560854-128560876 CTCTAATGGCCTGAGTTGGTTGG - Intergenic
1198798082 X:140420888-140420910 TTGATATGGTTGGAGTTGGTTGG + Intergenic
1198836912 X:140815560-140815582 CTGTAATGGCCTGTGTTGGTTGG + Intergenic
1199282866 X:146022351-146022373 CTGTAATGTTCTGAGTTGGTTGG - Intergenic
1199332768 X:146581751-146581773 CTGTAATGGACTGTGTTGGTGGG + Intergenic
1199553588 X:149081738-149081760 CTGTAATGGTTAGTGTTGGTTGG - Intergenic
1200372167 X:155739037-155739059 CTGAGATGGATTGAGTTCCTGGG + Intergenic
1200429031 Y:3055432-3055454 CTATAATGGCTTGAGTTGGTTGG + Intergenic
1200489733 Y:3810497-3810519 CTGTAATGGACTGTGTTGGTTGG - Intergenic
1200561328 Y:4707722-4707744 CTGTAATGGCTTGAATTGATTGG + Intergenic
1200595597 Y:5135864-5135886 CTGTAATGGCCTGAGTTGGTTGG - Intronic
1200662148 Y:5972859-5972881 CTGTAATGGCCTGAGTTGGTTGG - Intergenic
1200802493 Y:7399286-7399308 GAGAAATGGTTTGATTTGGTGGG - Intergenic