ID: 1100423418

View in Genome Browser
Species Human (GRCh38)
Location 12:94459839-94459861
Sequence GAGGATCCCGGTCCACGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100423418_1100423427 12 Left 1100423418 12:94459839-94459861 CCTCCGCGTGGACCGGGATCCTC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1100423427 12:94459874-94459896 CCACCCCACGTGCTGACGTATGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100423418 Original CRISPR GAGGATCCCGGTCCACGCGG AGG (reversed) Exonic
900587620 1:3440742-3440764 GAAGATGCCGGTCTACGAGGAGG - Intergenic
902081373 1:13823338-13823360 GAGGGTCCCGATCCCCGGGGCGG + Exonic
902402834 1:16167492-16167514 AAGGAGCCCGGGCCACGTGGAGG + Intergenic
903352921 1:22728952-22728974 GAGGTTCCAGCTGCACGCGGCGG + Intronic
916548431 1:165828026-165828048 GAGGCGCGCGGGCCACGCGGTGG - Intronic
1063443134 10:6089337-6089359 GAGGGTCTCAGTCCCCGCGGCGG + Exonic
1064443044 10:15370852-15370874 GAGGGTCCCGGGCCGCGTGGTGG - Intronic
1065214748 10:23439074-23439096 GAGGAGCGCGGTGCGCGCGGAGG - Intergenic
1069575059 10:69521165-69521187 GAGGATGCCTGCCCACGCTGGGG - Intergenic
1076637394 10:131891397-131891419 GAGGATCCTGGGAGACGCGGTGG - Intergenic
1079129309 11:17738219-17738241 GAGGGTCCCAGTCCACTCTGGGG - Intronic
1084325235 11:68396362-68396384 GAGGATTCCGTTCCACGTGGTGG + Intronic
1100423418 12:94459839-94459861 GAGGATCCCGGTCCACGCGGAGG - Exonic
1101144718 12:101830523-101830545 GAGGCGCCCGGTCCAGGCTGCGG + Intronic
1103285147 12:119794692-119794714 GAGAATCCAGCTCCACGTGGGGG - Intronic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1108680887 13:52779261-52779283 CAGGATCCCGTTCCACTCGTGGG - Intergenic
1128343248 15:66837237-66837259 GAGTGTCCCGGTCTAGGCGGAGG - Intergenic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1137617438 16:49856041-49856063 GGGGCTCCCGATCCAAGCGGCGG + Intronic
1141749747 16:85950338-85950360 GAGGTTCCCAGTCCACGGAGAGG - Intergenic
1142713106 17:1733963-1733985 GAGCTTCCCGGGCCACTCGGGGG + Exonic
1148122674 17:45222035-45222057 GAGGCTCCCGGCCCGGGCGGGGG - Exonic
1161241478 19:3225731-3225753 GAGAATGCTGATCCACGCGGAGG - Intronic
1161595074 19:5147041-5147063 GAGGCTCCCGGGGCAGGCGGAGG - Intronic
1162548655 19:11346220-11346242 GAGGGTCGCTGTCCACCCGGGGG - Intronic
1162908512 19:13837094-13837116 GAGGAGACCGGGCCACGGGGGGG - Intergenic
1162996280 19:14337800-14337822 GAGGATCCTGGGCCAGGGGGAGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
939410271 2:141815734-141815756 TTGGATCCCGTTCCACGCTGTGG + Intronic
942116781 2:172735882-172735904 GAGGAGCGGGGTCCGCGCGGCGG + Exonic
948728570 2:239949420-239949442 GAGGATGCCTGCCCACGCTGGGG - Intronic
1168814564 20:728090-728112 CCGGACCCCGGCCCACGCGGCGG - Intergenic
1176387645 21:6146845-6146867 GAGGATGCCCGCCCACGCAGGGG + Intergenic
1179595236 21:42438727-42438749 GAGGCTCAAGGTCCACGAGGGGG + Intronic
1179735827 21:43391403-43391425 GAGGATGCCCGCCCACGCAGGGG - Intergenic
1181571172 22:23768390-23768412 GAGACTCCCAGGCCACGCGGTGG - Exonic
950143533 3:10631995-10632017 GAGGGTCCCAGTCCAGGCTGAGG - Intronic
997990935 5:138543784-138543806 GAGGGTCCCGGACCGCCCGGAGG - Intergenic
1001749345 5:174117054-174117076 GAGGATCCCGGGCCTCGAGTCGG + Intronic
1006094838 6:31649354-31649376 GAGGAGCCCGTTCCACCAGGTGG + Exonic
1013538836 6:111087837-111087859 GAGGGTCCCGGGCCGGGCGGCGG - Exonic
1014797988 6:125748149-125748171 AAGGAGCCCGGTCGGCGCGGAGG - Intronic
1017007428 6:150038069-150038091 GAGGATGGGGGTCCTCGCGGAGG - Intergenic
1022100275 7:27165238-27165260 GTGGAACCCAGTGCACGCGGCGG - Exonic
1024581017 7:50800966-50800988 GAGGAACCCTGTCCAGGTGGAGG + Intergenic
1028391409 7:90321307-90321329 AAGGATCGCGGTCCCAGCGGCGG - Intergenic
1049440919 8:142609369-142609391 GGGGATCCCGGGCCAAGCTGCGG - Intergenic
1052372082 9:27676373-27676395 GAGGGTCCCCTTCCACGCTGTGG + Intergenic
1053435092 9:38069019-38069041 GCGGATCCCGGCCAAGGCGGAGG - Exonic
1203793701 EBV:164888-164910 GAGGACCCCGGTCGAGGCGTGGG - Intergenic