ID: 1100424976

View in Genome Browser
Species Human (GRCh38)
Location 12:94475762-94475784
Sequence TGGACCTTGAAAAAACTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100424974_1100424976 -5 Left 1100424974 12:94475744-94475766 CCACAGGCCACTGACTACTGGAC No data
Right 1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG No data
1100424970_1100424976 19 Left 1100424970 12:94475720-94475742 CCTTTTATCCTGGAGGGGATGTC No data
Right 1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG No data
1100424971_1100424976 11 Left 1100424971 12:94475728-94475750 CCTGGAGGGGATGTCTCCACAGG No data
Right 1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100424976 Original CRISPR TGGACCTTGAAAAAACTTTA CGG Intergenic
No off target data available for this crispr