ID: 1100427876

View in Genome Browser
Species Human (GRCh38)
Location 12:94504044-94504066
Sequence GCCTCCTAGAAACTGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100427876_1100427886 24 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427886 12:94504091-94504113 GCATCCTTACCTGGGGCTTTGGG No data
1100427876_1100427883 16 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427883 12:94504083-94504105 GAATAAGAGCATCCTTACCTGGG No data
1100427876_1100427885 23 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427885 12:94504090-94504112 AGCATCCTTACCTGGGGCTTTGG No data
1100427876_1100427882 15 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427882 12:94504082-94504104 GGAATAAGAGCATCCTTACCTGG No data
1100427876_1100427878 -6 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427878 12:94504061-94504083 GGAGGCAACCTCTAAGCCCTTGG No data
1100427876_1100427884 17 Left 1100427876 12:94504044-94504066 CCCTTGATCAGTTTCTAGGAGGC No data
Right 1100427884 12:94504084-94504106 AATAAGAGCATCCTTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100427876 Original CRISPR GCCTCCTAGAAACTGATCAA GGG (reversed) Intergenic
No off target data available for this crispr