ID: 1100429651

View in Genome Browser
Species Human (GRCh38)
Location 12:94519267-94519289
Sequence CCAGTGTTGAAAGTGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100429651_1100429659 7 Left 1100429651 12:94519267-94519289 CCAGACCCCACTTTCAACACTGG No data
Right 1100429659 12:94519297-94519319 ATTTCAACATAAGATCTGGAAGG No data
1100429651_1100429660 8 Left 1100429651 12:94519267-94519289 CCAGACCCCACTTTCAACACTGG No data
Right 1100429660 12:94519298-94519320 TTTCAACATAAGATCTGGAAGGG No data
1100429651_1100429658 3 Left 1100429651 12:94519267-94519289 CCAGACCCCACTTTCAACACTGG No data
Right 1100429658 12:94519293-94519315 TTACATTTCAACATAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100429651 Original CRISPR CCAGTGTTGAAAGTGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr