ID: 1100430301

View in Genome Browser
Species Human (GRCh38)
Location 12:94526271-94526293
Sequence TTGGGGCAGATGCAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100430301_1100430307 18 Left 1100430301 12:94526271-94526293 CCAACCAACTGCATCTGCCCCAA No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100430301 Original CRISPR TTGGGGCAGATGCAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr