ID: 1100430307

View in Genome Browser
Species Human (GRCh38)
Location 12:94526312-94526334
Sequence GCTAAATTATTTTCCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100430300_1100430307 23 Left 1100430300 12:94526266-94526288 CCACACCAACCAACTGCATCTGC No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430306_1100430307 -7 Left 1100430306 12:94526296-94526318 CCATTTTCTAAGTCTTGCTAAAT No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430304_1100430307 0 Left 1100430304 12:94526289-94526311 CCCAAAGCCATTTTCTAAGTCTT No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430305_1100430307 -1 Left 1100430305 12:94526290-94526312 CCAAAGCCATTTTCTAAGTCTTG No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430302_1100430307 14 Left 1100430302 12:94526275-94526297 CCAACTGCATCTGCCCCAAAGCC No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430303_1100430307 1 Left 1100430303 12:94526288-94526310 CCCCAAAGCCATTTTCTAAGTCT No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data
1100430301_1100430307 18 Left 1100430301 12:94526271-94526293 CCAACCAACTGCATCTGCCCCAA No data
Right 1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100430307 Original CRISPR GCTAAATTATTTTCCAGAAA TGG Intergenic
No off target data available for this crispr