ID: 1100433155

View in Genome Browser
Species Human (GRCh38)
Location 12:94548248-94548270
Sequence CCAGGCCTGCGCTGCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100433155_1100433164 20 Left 1100433155 12:94548248-94548270 CCCCCATGGCAGCGCAGGCCTGG 0: 1
1: 0
2: 0
3: 27
4: 254
Right 1100433164 12:94548291-94548313 GCTGCTGCCCCGCTTCCTGGTGG 0: 1
1: 2
2: 3
3: 34
4: 298
1100433155_1100433165 25 Left 1100433155 12:94548248-94548270 CCCCCATGGCAGCGCAGGCCTGG 0: 1
1: 0
2: 0
3: 27
4: 254
Right 1100433165 12:94548296-94548318 TGCCCCGCTTCCTGGTGGCCAGG 0: 1
1: 1
2: 7
3: 23
4: 257
1100433155_1100433163 17 Left 1100433155 12:94548248-94548270 CCCCCATGGCAGCGCAGGCCTGG 0: 1
1: 0
2: 0
3: 27
4: 254
Right 1100433163 12:94548288-94548310 AGCGCTGCTGCCCCGCTTCCTGG 0: 1
1: 1
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100433155 Original CRISPR CCAGGCCTGCGCTGCCATGG GGG (reversed) Intergenic
900355096 1:2257416-2257438 CAAGGCCTCCCCTCCCATGGTGG + Intronic
900568948 1:3348960-3348982 CCAGGCCAGCGCTGCCCCGGTGG - Intronic
900596549 1:3482713-3482735 GCAGGCCTGGGCTGCCAGTGAGG + Intergenic
900861851 1:5239352-5239374 CCAGGCATGGGCTGTCATGTGGG + Intergenic
901825586 1:11858988-11859010 TCGGGCCTGCCCTGCCATGCAGG + Intergenic
901842889 1:11964870-11964892 CCAGGCCTACGGTGACAAGGCGG - Intronic
902236366 1:15060105-15060127 CCTCGCCTGTGCTGCCTTGGCGG - Intronic
902397015 1:16137901-16137923 CCAGGCCTGAGACGCCATTGCGG + Exonic
902531049 1:17090995-17091017 CCAGGCCAGGGTTGTCATGGAGG - Intronic
903544886 1:24117851-24117873 GCAGGCCTGGGCTGCCTGGGAGG + Intergenic
903872645 1:26447710-26447732 ACAGGCGTGAGCTGCCATGCTGG - Intronic
905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG + Intergenic
907321609 1:53606269-53606291 CTAGGGCTGCTCTTCCATGGCGG - Intronic
907486129 1:54779472-54779494 CCTGGCCTCTGCTGCAATGGTGG + Intergenic
915139561 1:153758818-153758840 CCAGGCCTGGCCAGGCATGGTGG + Intronic
915579509 1:156805015-156805037 CCAGGCCTGGGCAGCTCTGGAGG + Intergenic
915637205 1:157195359-157195381 CCAGGCCTGGGCTGACATGCAGG - Intergenic
918438133 1:184537790-184537812 ACAGGCATGCGCTACCATGCCGG + Intronic
919748867 1:201024420-201024442 GGAGGCCTGAGCTGCCCTGGGGG + Intergenic
921325322 1:213982762-213982784 CCAGGCCTGCGCTGCCCCCGCGG - Intergenic
921930144 1:220748318-220748340 CCAAGCCTGCGCGGTAATGGAGG - Exonic
922423726 1:225475630-225475652 CCAGGACTGCCCCTCCATGGAGG + Intergenic
922751825 1:228073648-228073670 CCAGCCTTGCCCTCCCATGGTGG + Intergenic
922932396 1:229400421-229400443 CCATGCCTGGTCTGGCATGGTGG - Intergenic
923800642 1:237205459-237205481 CCGAGCCTGCAGTGCCATGGTGG + Intronic
1063965785 10:11344730-11344752 GCAGGCCTGTGCTGTCATCGAGG - Intergenic
1067039177 10:42939944-42939966 CCAGGCCTTTGTTGCCTTGGTGG - Intergenic
1068690190 10:59906418-59906440 CCAGCCCGCCGCGGCCATGGCGG - Exonic
1070102389 10:73400580-73400602 CCAGCCCTGTGTAGCCATGGAGG - Intronic
1070711810 10:78688650-78688672 CCAGGCCTCCCCTACAATGGAGG + Intergenic
1071306093 10:84299955-84299977 CCATCCCTGTGCTGCCTTGGAGG + Intergenic
1073634247 10:105181121-105181143 CCAGGCTTGTGCTAACATGGAGG + Intronic
1074290009 10:112131361-112131383 CCAGGCCTGCGATGCCACAGGGG + Intergenic
1074772389 10:116742463-116742485 CCGGGGCTGCGCGACCATGGCGG - Exonic
1076820981 10:132939465-132939487 GCAGGCCAGCTCTGCCATGTAGG + Intronic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077287370 11:1773539-1773561 CCAGGCCTGTCCAGCCCTGGGGG - Intergenic
1077419899 11:2445167-2445189 CCAGGCCCGCGCTGCCCCGCCGG - Exonic
1077465926 11:2733636-2733658 CCAGGCCTGGGCAGCCCTGGGGG + Intronic
1077756665 11:5037333-5037355 CCATGCCTTCACTGGCATGGAGG + Intergenic
1077757335 11:5046843-5046865 CCATGCCTTCACTGGCATGGAGG + Exonic
1078210978 11:9269215-9269237 ACAGGCCTGCGCCACCATGCCGG + Intergenic
1078658084 11:13261030-13261052 CGAGGTCGGCCCTGCCATGGAGG - Intergenic
1079121168 11:17686228-17686250 CCAGGCCAGGGACGCCATGGTGG - Intergenic
1080204446 11:29712878-29712900 CCAGCCCTGCCCTGCCCTGCAGG - Intergenic
1080511858 11:32982735-32982757 TCAGGCCTGGGCCACCATGGGGG - Intronic
1083265698 11:61545970-61545992 TCAGGCCTGCCCTGCCAGGGTGG - Intronic
1083282602 11:61636458-61636480 CCAGGCCTGAGATGCCCTGGGGG + Intergenic
1083962068 11:66020234-66020256 CCAGGCCTGCTCAACCCTGGAGG + Intronic
1084000779 11:66294402-66294424 CCACGCCTGCGGGGCCGTGGTGG + Exonic
1084177073 11:67428530-67428552 CGGGGCCGGCGCCGCCATGGCGG + Exonic
1084274568 11:68044793-68044815 TCAGCCCTGCTCTGCCCTGGTGG - Intronic
1084368422 11:68719134-68719156 CCTGGCCTGGCCTGCCATGGAGG - Intronic
1085337501 11:75707239-75707261 CAAGGCCTGGCCTGCCCTGGTGG - Intergenic
1090021008 11:123128372-123128394 ACAGGCCTGAGCTACCATGCTGG - Intronic
1090066958 11:123511343-123511365 CCGGGCCCGCACTGCCATTGGGG - Intergenic
1090184170 11:124725445-124725467 CCAGGCCTGCCCTGCCAGGAAGG + Intergenic
1090598270 11:128342762-128342784 CAATGCCTGGGCTGTCATGGAGG - Intergenic
1090977535 11:131690146-131690168 CCAGGCCTTCTCTGCCATCTTGG - Intronic
1095508667 12:42925605-42925627 ACAGGCATGCGCTTCCATGCTGG - Intergenic
1096065451 12:48736125-48736147 ACAGGCGTGAGCTACCATGGAGG - Intergenic
1100433155 12:94548248-94548270 CCAGGCCTGCGCTGCCATGGGGG - Intergenic
1100685995 12:96986213-96986235 CACGGCCTGCGCTGCCAGGCGGG - Intergenic
1102044863 12:109823310-109823332 CCAGACCTGCCCTGCCTGGGTGG - Intronic
1102470617 12:113157947-113157969 CCAGGCCCTCCCTGCCAGGGTGG + Exonic
1103510015 12:121467515-121467537 CCCGGCCTGCGGTGACACGGGGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104057214 12:125239734-125239756 CCCGGCGAGCGCTGCCGTGGAGG + Intronic
1104736051 12:131136575-131136597 CCATGCCTGCCCTTCCTTGGGGG - Intronic
1112562654 13:100527777-100527799 CCAGGCCGGCCCTGTGATGGAGG + Intronic
1113090139 13:106609340-106609362 CCAGGCTTGTGCTGACATGATGG + Intergenic
1113597079 13:111540731-111540753 CCAGGCCGGGGCTGCCCTTGGGG + Intergenic
1113743907 13:112729528-112729550 CCGGGCCTGCAATGCCAAGGTGG - Intronic
1114060087 14:19010224-19010246 CCAGGTGTGCGCTGCCTTTGGGG + Intergenic
1114060382 14:19011995-19012017 CCAGGTGTGCGCTGCCTTTGGGG + Intergenic
1114101971 14:19388611-19388633 CCAGGTGTGCGCTGCCTTTGGGG - Intergenic
1114102459 14:19391547-19391569 CCAGGTGTGCGCTGCCTTTGGGG - Intergenic
1114621217 14:24097420-24097442 ACAGGCATGCGCTGCCATGCTGG - Intronic
1117214691 14:53538291-53538313 CCCTGCCTGGGCTGCCCTGGTGG + Intergenic
1119662576 14:76462474-76462496 CCAGCCCTGCGCTGGCAGGTGGG + Intronic
1119718428 14:76874905-76874927 CCAGGCCTGCCTTGCCAAGTGGG + Intergenic
1121333661 14:93063603-93063625 CCAGGACTGCACAGCCTTGGAGG + Intronic
1121339925 14:93099147-93099169 CCAGGCCTGCTCAGCTGTGGGGG + Intronic
1121709543 14:96027366-96027388 CCTGGCCTGGGCTGCCTTGCAGG + Intergenic
1121769793 14:96523578-96523600 CCAGGTCAGCGTTGCCATTGAGG + Intronic
1122807051 14:104265008-104265030 CCGGGGCTGCACTGCCCTGGTGG - Intergenic
1122857588 14:104567293-104567315 CCAGGGCTGCCCTGGCCTGGGGG + Intronic
1122904450 14:104795449-104795471 CCAGGCCCGGGCGGCCACGGCGG + Intronic
1124441500 15:29689210-29689232 ACAGGGCTGGGCTGGCATGGCGG - Intergenic
1125754887 15:42056952-42056974 CAAGGCCGGCCCTGCCAGGGTGG - Intergenic
1129193576 15:73951718-73951740 CCATGCCTGCCCTGCCACGAGGG + Intronic
1129198246 15:73983637-73983659 CCAGGCCTGCCCTGCCCTGCTGG - Exonic
1129858292 15:78840810-78840832 CCAGTCCTGCCCTGCCCTGCTGG + Intronic
1130654174 15:85780406-85780428 CCAGGCCAGTCCTGCCATAGAGG - Intronic
1130971755 15:88739336-88739358 CGAGGCCTGGCCTGCCAGGGAGG - Intergenic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1132674565 16:1116385-1116407 CCAGGACTGCCCCACCATGGGGG + Intergenic
1132874903 16:2132678-2132700 CCAGGCCTTCGGTGGCATGAAGG + Intronic
1134438905 16:14285877-14285899 CCGCGCCTGCGTTGCGATGGCGG - Intergenic
1134520088 16:14914704-14914726 CCAGGCCTTCGGTGGCATGAAGG - Intronic
1134553845 16:15151528-15151550 CCAGGCCTTCGGTGGCATGAAGG + Intergenic
1134707762 16:16313358-16313380 CCAGGCCTTCGGTGGCATGAAGG - Intergenic
1134831036 16:17323053-17323075 GCAGCCCTGACCTGCCATGGAGG - Intronic
1134959781 16:18398767-18398789 CCAGGCCTTCGGTGGCATGAAGG + Intergenic
1135716993 16:24779914-24779936 CCAGCCCTGGGCTGCCATTTTGG + Intronic
1136620774 16:31427302-31427324 GCAGCCCTGGGCTCCCATGGGGG + Intergenic
1138144597 16:54597174-54597196 ACAGGCTTGCCCTGCCCTGGGGG - Intergenic
1138659410 16:58508682-58508704 CGAGGGCTGGGCTGCCGTGGTGG - Intronic
1140352015 16:74271319-74271341 CCAGGCCTGTGGTGGGATGGTGG + Intergenic
1141082792 16:81067692-81067714 ACAGGCGTGCGCTACCATGCAGG + Intronic
1141665991 16:85465370-85465392 CCAGGCCTGGGCTCCCATCTGGG + Intergenic
1141703531 16:85653032-85653054 CCAGGCCTACCCTGACCTGGGGG - Intronic
1144668062 17:17115422-17115444 CCAGGCCTGGGTTGGCAGGGAGG + Intronic
1146887629 17:36483132-36483154 CCAGGCCCGCACTGCCCGGGTGG - Intergenic
1148063003 17:44849344-44849366 ACAGGCCTGCGCTGCCACTCGGG - Exonic
1149470711 17:56913391-56913413 CCAGGCCAGCGCCGACCTGGAGG - Exonic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1150210958 17:63441214-63441236 ACACGTCTGCCCTGCCATGGTGG - Intronic
1151202317 17:72477685-72477707 CCAGGCCTCGGCTGCCATATTGG + Intergenic
1151515788 17:74594579-74594601 ACAGGCGTGCGCTGCCATGCTGG - Intergenic
1152431092 17:80248616-80248638 CCTGTCCTTCCCTGCCATGGAGG + Exonic
1152569447 17:81115304-81115326 CCAGCCCAGCCCTGGCATGGGGG - Intronic
1152575161 17:81136638-81136660 CCAGTGCTGGGCGGCCATGGGGG + Intronic
1155365905 18:25048738-25048760 ACAGGCATGCACTGCCATGCTGG - Intergenic
1156462806 18:37331138-37331160 CCAGCGCTGCGCTGCCTGGGCGG + Intronic
1156967460 18:43112371-43112393 CCATGCCTGCCATGCAATGGGGG + Intronic
1157386582 18:47263478-47263500 CCCGGCCCGCGCTGCCCTGCAGG - Intergenic
1159338461 18:67101702-67101724 CCAGTCCTGCGCTGGCATTCAGG - Intergenic
1160592115 18:79950920-79950942 CCAGGCGGGCGCTGCGATGGAGG - Exonic
1160804238 19:984771-984793 TCAGGCCTGAGCTGCTATGGGGG + Intronic
1160831544 19:1106862-1106884 CCAGGCTGGGGGTGCCATGGAGG + Intergenic
1160874293 19:1290090-1290112 CCAGGCCTGCTCTGCGAAGTGGG + Intronic
1161044313 19:2126967-2126989 CCAGGCCTCTGCTGTCAAGGTGG - Intronic
1161332234 19:3693785-3693807 ACAGGCATGCGCCCCCATGGTGG - Intronic
1161979839 19:7624621-7624643 CCTGCCCTGCACTGCCAGGGTGG + Intronic
1162079446 19:8209556-8209578 CCCCGCCTCCGCGGCCATGGCGG + Intronic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1166258920 19:41624878-41624900 CCAGGGGTGCTCTCCCATGGAGG - Intronic
1166399277 19:42466064-42466086 CCTGCCATGCTCTGCCATGGAGG + Intergenic
1167380809 19:49136929-49136951 CCCGGCCTGCCCTGCCCTGCCGG + Intronic
1167579846 19:50334918-50334940 CCAGGGCTGTGCTGCCATCCTGG - Intronic
1168138775 19:54370383-54370405 CCTGGCCTGGGCTCCGATGGTGG + Intronic
1168159248 19:54498114-54498136 CCTGGCCTGGGCTCCGATGGTGG - Intronic
927931792 2:27050174-27050196 CCAGGCCCGCGATCCCAGGGCGG + Intronic
927964567 2:27261330-27261352 CCAGGCCAGAGCTTCCCTGGAGG + Intronic
929814670 2:45221445-45221467 CCAGACCTGGCCAGCCATGGTGG - Intergenic
930358037 2:50346042-50346064 CCAGCCCTTCGCAGGCATGGAGG - Intronic
932590549 2:73064121-73064143 CAAGGCCTGCTCTTCCCTGGGGG - Intronic
934056837 2:88258356-88258378 CAAGCCCTGGGCTGCCCTGGAGG - Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
938451271 2:131423755-131423777 CCCGCCCTGCCCTTCCATGGTGG - Intergenic
942646134 2:178112777-178112799 ACAGGCCTGCAGGGCCATGGAGG + Exonic
948689639 2:239693888-239693910 CCAGGGCTGCAGGGCCATGGGGG + Intergenic
948922070 2:241070536-241070558 TCAGGCCTGGGCTGCAATGCAGG - Intronic
1169824024 20:9746264-9746286 CAAGACCTGCACTGCCATGATGG - Intronic
1171428551 20:25064092-25064114 CCAGGCCTGCAGGGCCAAGGGGG + Intergenic
1171453031 20:25248829-25248851 CCAGGCCTGGGCAGCCTTGTGGG + Intronic
1172444257 20:34984877-34984899 CGAGGCCAACCCTGCCATGGAGG + Exonic
1172794140 20:37525510-37525532 CCAGGCAAGGGCTGCCCTGGTGG + Intronic
1173108393 20:40160357-40160379 CCAGGGCTGGGCGGCCATGGGGG + Intergenic
1173221574 20:41136866-41136888 CCAGCCCCGCGCTGCCGGGGGGG + Intergenic
1173761506 20:45564698-45564720 ACAGGTGTGCGCTGCCATGCTGG - Intronic
1174280422 20:49435062-49435084 ACAGGCCTCATCTGCCATGGTGG - Intronic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1174483882 20:50849387-50849409 CCAGGCCTCTGCTGCCCTGGTGG - Intronic
1175988806 20:62777444-62777466 CCAGGGCTCTGCTGCCCTGGCGG - Intergenic
1176205389 20:63885399-63885421 CCAGGCCCACTCTGACATGGAGG - Intronic
1176410610 21:6447748-6447770 CCAGGCCTGGGCAGGCGTGGTGG - Intergenic
1178707758 21:34889200-34889222 CCAGGCCTCCGCTTCCAGGGCGG + Intronic
1179071311 21:38073645-38073667 CCAGGCATGGGCTGCAACGGAGG + Intronic
1179686104 21:43056070-43056092 CCAGGCCTGGGCAGGCGTGGTGG - Intronic
1180478568 22:15732836-15732858 CCAGGTGTGCGCTGCCTTTGGGG + Intergenic
1180478863 22:15734607-15734629 CCAGGGGTGCGCTGCCTTTGGGG + Intergenic
1182472567 22:30557454-30557476 CCAGGCCTGGGCAGCCTTGGGGG - Intronic
1183184766 22:36285594-36285616 CAAGGCCAGCTCTGCCGTGGTGG + Intronic
1183207739 22:36431297-36431319 TCAGGCCTGCTCTGAGATGGAGG - Intergenic
1183288275 22:36981624-36981646 GCAGCCCTCCCCTGCCATGGGGG + Intergenic
1183729013 22:39606672-39606694 ACAGGCATGCGCCGCCATGCCGG + Intronic
1183989201 22:41586828-41586850 CCAGGCATGGGCTGGCACGGTGG + Intronic
1184246198 22:43237005-43237027 CCAGGGCTGGGCGTCCATGGAGG + Intronic
1184453552 22:44596871-44596893 CCTGCCCTGCGCTGCTGTGGTGG - Intergenic
1185045603 22:48527273-48527295 CCAGGCCTGGGCTGCAGTTGGGG - Intronic
949560345 3:5195775-5195797 CCATGCCTGAGCTGCCAACGTGG + Intronic
950406887 3:12810341-12810363 CGGGGCCTGGGCTGGCATGGTGG + Intronic
950781720 3:15398143-15398165 CCAGGCCAGCCATGCCATGTGGG - Intronic
954105034 3:48405379-48405401 CCAGGCCTGCACTTGCATGTTGG + Intronic
954259563 3:49428869-49428891 CCAGGACAGCGCTGGCATGCAGG - Intronic
954427152 3:50449469-50449491 GCAGGGCTGCGCAGCCATGGAGG - Intronic
956290391 3:67654557-67654579 CCCGGCCTGCGCTGCTACGGGGG + Exonic
956979801 3:74622621-74622643 CCATGCCTGAGCTGCCAAGAAGG + Intergenic
962867748 3:139461730-139461752 CCAGCCAAGCACTGCCATGGAGG - Intronic
966529010 3:180952972-180952994 ACAGGCATGTGCTGCCATGCTGG + Intronic
967249808 3:187525397-187525419 ACAGGCCTGAGCTACCATGCCGG + Intergenic
968504814 4:966871-966893 CCACGCCTGGGCTGGGATGGTGG + Intronic
968706352 4:2080218-2080240 CCAGGCCTTGGCTGGCAAGGAGG + Intronic
969247401 4:5944628-5944650 CCTGGCCTGTGCTGGGATGGAGG + Intronic
969642123 4:8405226-8405248 CCAGGCCTGTGCTGGGATGCAGG - Intronic
969690731 4:8702737-8702759 CCATGCCAGGGCTTCCATGGTGG - Intergenic
976513488 4:85937113-85937135 CCAGCCAAGTGCTGCCATGGTGG - Intronic
981008165 4:139896938-139896960 CCAGGCCTCTGCTGACACGGGGG + Intronic
982743739 4:159084825-159084847 CCAGGCCTGGTCAGCCATGAGGG - Intergenic
984287087 4:177744482-177744504 TCATGACTGCCCTGCCATGGAGG - Intronic
984863220 4:184257884-184257906 CCACTTCAGCGCTGCCATGGTGG - Intergenic
985552634 5:541285-541307 ACAGGGCTGCGCTGGCCTGGGGG + Intergenic
985593302 5:776294-776316 CCAGGGCTTCGGTGCCAAGGTGG - Intergenic
989165906 5:38433445-38433467 CCAGGCCTGCTCTGCAGTGAGGG - Intronic
990381204 5:55223314-55223336 GCAGGCTTGCACTGCCACGGTGG + Intronic
990515841 5:56530269-56530291 CCAGGCCTGGGCAGCCAGCGAGG - Intronic
991921710 5:71663796-71663818 ACAGGCATGCGCCGCCATGTGGG + Intergenic
994226054 5:97253208-97253230 CCAGTGCTGCCCTGTCATGGTGG + Intergenic
996379078 5:122845618-122845640 GCTGGCCGGCGCGGCCATGGAGG + Exonic
997309229 5:132866274-132866296 CCTGGCCAGCGCTGCCCCGGAGG + Intronic
999217085 5:149944349-149944371 CCAGCTCTGCGATGCCATTGCGG + Exonic
1001296877 5:170504557-170504579 TCAAGTCTTCGCTGCCATGGGGG + Exonic
1002186943 5:177458970-177458992 CCAAGACTGCACTGCCCTGGAGG - Intronic
1003080693 6:3018591-3018613 CCAGGCCTGCCCTGTCAGGTGGG - Intronic
1004403757 6:15312525-15312547 GCAGGTCGGCGCTGGCATGGGGG - Intronic
1006338024 6:33431210-33431232 CCAGGCCTGGGCAGCCATTCTGG + Intronic
1006585788 6:35110648-35110670 ACAGGCATGAGCTGCCATGCTGG + Intergenic
1007718732 6:43872670-43872692 AGAGGCTTGCGCTGCCATGTGGG + Intergenic
1016702558 6:147069933-147069955 CCTGGCCTCAGCTGGCATGGAGG - Intergenic
1018481371 6:164194475-164194497 GTAGGCCTGCTCTGCCAGGGAGG - Intergenic
1019171718 6:170136648-170136670 CCAGCCCTGCGCGGCACTGGAGG - Intergenic
1019187488 6:170229302-170229324 CCAGGCCTCCCCTGCCCTGCTGG + Intergenic
1019430528 7:996926-996948 CCTGGCGTGCGCTGGCATGGGGG + Intergenic
1019718525 7:2554517-2554539 CCAGGCCTGAGCAGGCATGGTGG - Intronic
1020083159 7:5297120-5297142 CCAGGCCTGGCCTGCCCCGGTGG - Exonic
1020275516 7:6622340-6622362 CACGGCCGGCGCTGCCACGGCGG - Exonic
1020318598 7:6924515-6924537 CCAGGCCACCCCTGCCATCGAGG - Intergenic
1025144389 7:56492042-56492064 CCAGGCATGCCCTGCCTTGTGGG + Intergenic
1025211124 7:57020067-57020089 CCAGGCCTGGCCTGCCCCGGCGG + Intergenic
1025660831 7:63556780-63556802 CCAGGCCTGGCCTGCCCCGGCGG - Intergenic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1028585904 7:92451395-92451417 CCAGGCCTGCCGAGCCTTGGGGG - Intronic
1029220111 7:98981973-98981995 ACAGGCCTGTGCTCGCATGGGGG - Intronic
1031069554 7:117146585-117146607 TCTGGCCTGAGCTGCCATTGTGG - Intronic
1033200014 7:139360257-139360279 CTGGGCCTGCGCCGACATGGCGG - Exonic
1033362437 7:140647128-140647150 CCAGCCCTTCGCAGCCAGGGAGG - Intronic
1034181656 7:149143668-149143690 ACAGGCATGCGCCACCATGGGGG - Intronic
1034188305 7:149195775-149195797 CCATGGCCGCGCTGCCGTGGGGG + Intronic
1035117094 7:156533691-156533713 CCAGGGCTGGCCTGGCATGGAGG - Intergenic
1035249494 7:157587848-157587870 CCATGCCTGGGCTCCCGTGGTGG + Intronic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037756714 8:21714991-21715013 CAAGGCCTGCACTGCCAGAGGGG - Intronic
1037936895 8:22921061-22921083 CCCGGCCTGCCCTGCCCTGCAGG - Intronic
1038410845 8:27358175-27358197 ACAGCCCTGTGCTGCCCTGGGGG - Intronic
1038613984 8:29076260-29076282 CCAGGCCTGGCCTCCCATGCTGG + Intronic
1039379030 8:37067611-37067633 CCAGGCCTGTGCGCCCATGGCGG - Intergenic
1039956969 8:42215112-42215134 CGAGTCCTGTGATGCCATGGCGG - Intergenic
1040451064 8:47547705-47547727 ACAGGCATGAGCTGCCACGGTGG + Intronic
1042147174 8:65742285-65742307 CCAGGCCTGCGTTGTCAGGGTGG - Intronic
1048273182 8:133045669-133045691 ACAGGCCTGAGCTACCATGCCGG + Intronic
1049582779 8:143420412-143420434 CCAGGCCACCCCCGCCATGGTGG - Intronic
1049594117 8:143475664-143475686 CCAGGCCTGGCCTCCCAAGGGGG + Intronic
1049625281 8:143617182-143617204 CGAGGCCTGTCCTGCCCTGGAGG - Intronic
1049690199 8:143954937-143954959 CCAGGCTGGGGCTGGCATGGAGG + Intronic
1054769229 9:69068640-69068662 CCAGGCGTGCACTGCTGTGGTGG + Intronic
1056820167 9:89835842-89835864 CCAAGCCTGAGCTGTCCTGGAGG + Intergenic
1056899404 9:90584041-90584063 CCAGGTATGCACTGCCGTGGTGG + Intergenic
1058137059 9:101318630-101318652 ACAGGCATGCGCTACCATGCCGG - Intronic
1058866504 9:109166715-109166737 CCAGGCCTCCGCCGGCCTGGAGG - Intronic
1061014910 9:127975962-127975984 CCAGGCCTGGGCTGGCACTGGGG - Intronic
1061649498 9:132035673-132035695 CAAGGCCTGGTCAGCCATGGTGG + Intronic
1061804260 9:133129268-133129290 CCAGGCCTGCCGTGCCCAGGGGG - Intronic
1061824203 9:133247685-133247707 CAGGGCCTGGGCTGCAATGGTGG + Intergenic
1062274846 9:135725890-135725912 CCAGACCTGGGCTCCCAGGGCGG - Intronic
1062353167 9:136148947-136148969 CCTGGCCTCAGCTGCCCTGGGGG - Intergenic
1062398177 9:136360944-136360966 CCAGGCCTGCTCCTCCATGGAGG - Intronic
1185615693 X:1420501-1420523 CTCGGCCAGCGCTGCCAAGGAGG + Intronic
1185754439 X:2642308-2642330 GCAGGGCTGCGCTACCCTGGAGG + Intergenic
1189112197 X:38302950-38302972 ACAGGCACGCGCTGCCATGCTGG + Intronic
1192144526 X:68672720-68672742 CCTTGGCTGCCCTGCCATGGGGG - Intronic
1192259119 X:69493465-69493487 CCAGGTCTGCGCTGGCCTGCAGG - Intergenic
1194481123 X:94425325-94425347 ACAGGCATGCGCCACCATGGCGG + Intergenic
1195129628 X:101839998-101840020 CCTGTCCTGGGCTGGCATGGGGG - Intronic
1195176610 X:102319831-102319853 CCTGTCCTGGGCTGGCATGGGGG + Intronic
1195182254 X:102367262-102367284 CCTGTCCTGGGCTGGCATGGGGG - Intronic
1197740095 X:129884671-129884693 ACAGGCGTGCGCTACCATGCCGG - Intergenic
1200060248 X:153480821-153480843 CCAGGCCACAGCTGCCATGAGGG + Intronic
1200093118 X:153644901-153644923 CCCGGCCCGCCCTGCCGTGGGGG - Intronic
1200252579 X:154561578-154561600 CCAGGCCTGTGATGCGAGGGAGG + Intronic
1200265188 X:154642838-154642860 CCAGGCCTGTGATGCGAGGGAGG - Intergenic