ID: 1100435566

View in Genome Browser
Species Human (GRCh38)
Location 12:94568335-94568357
Sequence GTCTCCTGTGGGTCTTGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100435566 Original CRISPR GTCTCCTGTGGGTCTTGAGT TGG (reversed) Exonic
901515630 1:9744035-9744057 TTCTCCTTTGGATCTTTAGTTGG - Intronic
902794590 1:18793048-18793070 TACTCCTGGGGGTCTTGGGTGGG - Intergenic
903540782 1:24095080-24095102 TTCTCTTCTGGGTCTTGACTAGG + Intronic
907118149 1:51987777-51987799 GCCAACTGTGGTTCTTGAGTAGG - Intronic
907904248 1:58769836-58769858 TTCTTCGGTGGGTCTTAAGTGGG - Intergenic
908666110 1:66493199-66493221 GTTTCCTGTGGGCCATGTGTAGG + Intergenic
910236863 1:85046093-85046115 GTCTGCTGTGGGTGTTAGGTAGG - Intronic
913213052 1:116597657-116597679 GTGTCTTGGGTGTCTTGAGTTGG - Intronic
916262551 1:162856837-162856859 GTCTCCTTGGGGTCTTTTGTGGG + Intronic
918454099 1:184689250-184689272 GTCTCCTGCGGCTATTTAGTGGG + Intergenic
1068810010 10:61244653-61244675 GTCTCCTGGGGTTCTTGATGGGG + Intergenic
1070668663 10:78362981-78363003 CCCTCCTGTGGGTCTGGGGTTGG - Intergenic
1071389153 10:85153031-85153053 GTGCCCTGTGGGCCATGAGTTGG + Intergenic
1071520101 10:86325434-86325456 GTCTCTTTTGGGTCTCGAGAGGG - Intronic
1073184969 10:101610448-101610470 GTCACCTGTGGGTTTGGAGAGGG - Intergenic
1074133103 10:110600662-110600684 GTGTCTTGTGGGCCTTGGGTTGG + Intronic
1076626441 10:131824177-131824199 GTCTCCTGTGGGGGTTTAGGCGG - Intergenic
1076712706 10:132347472-132347494 GTGTCCTGTGGGGCTTGTGTGGG + Intronic
1077403457 11:2370149-2370171 TCCTCCAGTTGGTCTTGAGTTGG - Intergenic
1079640684 11:22801275-22801297 GCTTCCTGTGGGTCTTGGGGAGG - Intronic
1080079308 11:28195856-28195878 GTCTTCAGTCTGTCTTGAGTTGG + Intronic
1081984787 11:47293729-47293751 TTTTCCAGTGGGTCCTGAGTGGG + Intronic
1082139818 11:48595766-48595788 GTCTTCTGTTGCTCTTGAGGGGG + Intergenic
1083161289 11:60855809-60855831 TTCTTCTGTGGGTCTAGAGAGGG + Intronic
1083831412 11:65236269-65236291 TTCTCCTCTGGGTTCTGAGTGGG + Intergenic
1084805008 11:71572695-71572717 CTCTCCTGTGGGTCTGGGGATGG - Intergenic
1088920439 11:114256976-114256998 GTGTCCCCTGGGTCTTGAGGAGG - Intergenic
1092228497 12:6764311-6764333 GTCCCCTGTGGGGCTGGAGTTGG + Intronic
1092601934 12:10076302-10076324 GTCTCTTGTGGGTCTGTAGTGGG + Intronic
1093042954 12:14405737-14405759 AACTCCTGTGGGTTTTTAGTAGG + Intronic
1093275393 12:17118880-17118902 GTCTCCTGTGATTATTGTGTGGG - Intergenic
1094384273 12:29876922-29876944 GTCTCATGTGAGGCTTGATTGGG + Intergenic
1094615401 12:32031937-32031959 TTCTCCTGTGGGTCCTAAATTGG + Intergenic
1096779587 12:53984439-53984461 GTTTCCTGTGGGGGTTGACTGGG - Intergenic
1097792129 12:63826250-63826272 CTCTCCTCTGGCTCTTAAGTTGG - Intergenic
1098045973 12:66401015-66401037 GTGTCCAGTGGTTCTTGTGTGGG - Intronic
1099007368 12:77250140-77250162 GTCTCCTGTGACTCTGCAGTGGG + Intergenic
1099675948 12:85760422-85760444 GTTTCCTTTGTGTCTGGAGTAGG + Intergenic
1100435566 12:94568335-94568357 GTCTCCTGTGGGTCTTGAGTTGG - Exonic
1104857257 12:131908032-131908054 GTGTCCTGAGGGTCTGGAGGTGG + Intronic
1105216294 13:18288271-18288293 GTGTCTTGGGTGTCTTGAGTTGG - Intergenic
1107454350 13:40540431-40540453 GTCTCCAGTTGGTCTATAGTGGG + Intergenic
1109884559 13:68525385-68525407 GTCTCCTGTGATTATTGTGTGGG - Intergenic
1110273844 13:73620607-73620629 GTCCCTTGTTTGTCTTGAGTAGG + Intergenic
1111262471 13:85760287-85760309 GTATCCTGGGGTTCTTGCGTTGG + Intergenic
1113846681 13:113395765-113395787 GTCTGCTGTGGGTTTTGATGGGG + Intergenic
1116706280 14:48305961-48305983 AACTCCTTTAGGTCTTGAGTAGG - Intergenic
1120338513 14:83189745-83189767 GACTCCTGTGGCTCCTGACTGGG - Intergenic
1121240347 14:92425408-92425430 TTCTCTTGTTGTTCTTGAGTTGG + Intronic
1121723567 14:96129623-96129645 GTCACCTGAGGGTCCTGAGTGGG + Intergenic
1121935797 14:98017326-98017348 GTCTCCTCCTGGGCTTGAGTGGG - Intergenic
1122230267 14:100303490-100303512 CTCTCCTGGGAGACTTGAGTGGG - Intronic
1122306212 14:100768396-100768418 GTCTCCCATGGGTCTGCAGTGGG + Intergenic
1124200130 15:27672213-27672235 TTCTCCAGTAGGTCCTGAGTTGG + Intergenic
1129237808 15:74234247-74234269 GTCTCCTGTGGGTAGGGGGTGGG + Intergenic
1129466791 15:75728600-75728622 AGCTCCTGTTGGTCTTGAGGAGG + Intergenic
1129720454 15:77875178-77875200 AGCTCCTGTTGGTCTTGAGGAGG - Intergenic
1130228718 15:82080327-82080349 GTCTCTTGTGTGTGTGGAGTTGG - Intergenic
1131070549 15:89463053-89463075 ATCTCCTGAGGGTCCTGAGTTGG - Intergenic
1132480853 16:165460-165482 GTCTCCTGGGGTCCTTGAGTCGG + Intronic
1132714641 16:1284636-1284658 GTCTGCTGTCTGTCCTGAGTCGG - Intergenic
1137441408 16:48501649-48501671 AGCCCCTGTGGCTCTTGAGTAGG - Intergenic
1138864945 16:60806149-60806171 GTCTCCTGTGGTTATTGTATTGG - Intergenic
1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG + Intergenic
1146712920 17:35058287-35058309 GTCTCCTGGGGGTGTTGTGTTGG - Intronic
1148657693 17:49300245-49300267 ATCTCTTGTGGGTATTCAGTAGG - Intronic
1150185215 17:63173461-63173483 TTCTCCAGTTGGTCTTAAGTTGG - Intronic
1150426561 17:65081900-65081922 GTCTCCTGTGGGTGACGAGGAGG + Intergenic
1151146454 17:72046168-72046190 TCCTCCTGTGGGTCTGAAGTTGG - Intergenic
1152458314 17:80428476-80428498 GTGACCTGTGTGTCCTGAGTGGG + Intronic
1153692213 18:7605265-7605287 GTGTCCTGTGGGCCATGGGTTGG + Intronic
1157553425 18:48597042-48597064 GTCTCCTGGGGATGCTGAGTGGG + Intronic
1157762924 18:50277192-50277214 GTCTCCTGTGGGGCTAGGGATGG + Exonic
1159243562 18:65775741-65775763 GTAGCCTGTGGGCCTTGAGTTGG + Intronic
1160046413 18:75391107-75391129 CTCCCCTGTGGGTCTGGAGCAGG - Intergenic
1160175450 18:76590452-76590474 GTCTCCTGAAGGTCTTGACCAGG - Intergenic
1161736106 19:5992960-5992982 TTCCCCTCTGGGTCTTGAGTGGG + Intergenic
1165104171 19:33459148-33459170 GTCTCCAGTGGGTCTTGGCCTGG + Intronic
1166497583 19:43315496-43315518 TCCCACTGTGGGTCTTGAGTGGG + Intergenic
1167303922 19:48696216-48696238 CTCTCCTGGAGGTCCTGAGTTGG - Intronic
927281040 2:21306826-21306848 TTCTCCTGTGGTTCATAAGTAGG + Intergenic
929998138 2:46842277-46842299 GTCTCCTGCTGGTCTTGCCTGGG + Intronic
931470153 2:62531550-62531572 GTATCCTGGGGTTCTTGGGTTGG + Intergenic
933191811 2:79342396-79342418 GTTTGCTATGGGTCTTGACTAGG + Intronic
935684148 2:105668849-105668871 TTCTCCTGTGGATCCTAAGTTGG + Intergenic
937146902 2:119655221-119655243 TTCCCCTGTGGGTCTTGAAAGGG - Intronic
937150523 2:119682873-119682895 GTCTCCCCTGGGTCCTGAGTGGG - Intronic
937278508 2:120701862-120701884 GCCACCTGTGGCTGTTGAGTAGG - Intergenic
937960843 2:127457113-127457135 CTCTCCTGTGTGCTTTGAGTTGG - Intronic
940984902 2:160043186-160043208 GTCTCTTGCGGGTTTTGAATGGG + Intronic
947859190 2:233347045-233347067 TTCTCCCCTGGGTCATGAGTTGG + Exonic
948855845 2:240730221-240730243 GTCCCATGTGGGTCCTGTGTGGG - Intronic
1171440022 20:25152705-25152727 GTTTCCTGTGGGGCTGGACTGGG - Intergenic
1175663926 20:60842252-60842274 GTCTTCTATGGGTCTTGATATGG - Intergenic
1175717613 20:61265915-61265937 GTCCCTTGTGGGTCCTGAGGTGG + Intronic
1175772450 20:61632402-61632424 GGCACCTGTGGGTGGTGAGTTGG - Intronic
1175794558 20:61763531-61763553 GTGTCCAGAGGGTCTGGAGTGGG + Intronic
1176606528 21:8838666-8838688 GTCTACTGTGGGTGGAGAGTTGG - Intergenic
1177104095 21:16933128-16933150 GTGGCCTGTGGGTCATGGGTTGG - Intergenic
1179452594 21:41475870-41475892 GTCTTCTTTAGGTCCTGAGTGGG - Intronic
1180122949 21:45766062-45766084 GTCTCCTGTGGGACTGACGTGGG + Intronic
1180142742 21:45902150-45902172 TTTTCCAGTGGGTCCTGAGTTGG + Intronic
1180976856 22:19853477-19853499 GTTTCCTGGAGGTCGTGAGTGGG - Intronic
1184443873 22:44535879-44535901 GTCCCCCATGGGTCTTGTGTGGG + Intergenic
949102732 3:165486-165508 GTGTCCTGTGGGTCATGATATGG - Intergenic
951976083 3:28510687-28510709 CTCTCCTGTAGGTCTAGGGTTGG - Intronic
952738235 3:36711100-36711122 GGCTCCAGTGCCTCTTGAGTTGG - Intergenic
953508910 3:43515477-43515499 GTCAAGTGTGGATCTTGAGTTGG + Intronic
953787261 3:45920622-45920644 GTCTCCTGGAGGTCTGGTGTGGG + Exonic
955026502 3:55172618-55172640 GTCTCATCTGAGTCTTGACTGGG - Intergenic
960380901 3:116960408-116960430 GGCTCCTGTGGGTCCTGGCTTGG - Intronic
961376929 3:126473471-126473493 GTCTCTTGAGGGTTTTGTGTTGG - Intronic
961424482 3:126834468-126834490 GTCGCCTGTGGGTGTGGAGCTGG + Intronic
963104890 3:141638705-141638727 GTCGCATGTGGGTGTTCAGTGGG + Intergenic
972702622 4:41508631-41508653 GTCTCCCCTGGGTCATGGGTGGG + Intronic
972879860 4:43410085-43410107 CTCTGGTGTGGGTCTTGAGGAGG + Intergenic
972904478 4:43728224-43728246 GTATGCTGTGGGCCTTGGGTGGG + Intergenic
975763086 4:77636673-77636695 GTCTCCTGTGAGTGTGGAGAAGG - Intergenic
976415701 4:84771976-84771998 CTCTCCTGTGCTTCATGAGTAGG - Intronic
981316887 4:143349319-143349341 CTCTGGTGTGGGTCTTGACTAGG + Intronic
983366203 4:166793536-166793558 GTGGCCTGTGGGCCATGAGTTGG + Intronic
983970357 4:173864004-173864026 GTCTCTTGTGGGCCTAGAGAAGG - Intergenic
985750739 5:1672789-1672811 GTATGCAGTGGGTCTTGAGGTGG + Intergenic
986089691 5:4492506-4492528 GTCCTCTGTGGGTATCGAGTGGG - Intergenic
986563926 5:9091662-9091684 TTGGCCTGTGGGTCTTCAGTAGG - Intronic
986739373 5:10692699-10692721 GTGTCCTGTGGGGACTGAGTAGG - Intronic
987714085 5:21544242-21544264 GTCTTCTATGGGTCTATAGTTGG - Intergenic
990979810 5:61592505-61592527 GTATGCTGTTTGTCTTGAGTAGG - Intergenic
991648085 5:68821446-68821468 GTCTCCTGTGGCTGTAGAGCAGG + Intergenic
994438486 5:99769455-99769477 GTCACCTGTGGGTTTTGCTTAGG + Intergenic
994967396 5:106691941-106691963 GTGTCCTCTGGGTCTGAAGTGGG + Intergenic
995732857 5:115264692-115264714 CTCTGGTGTGGGTCTTGAGGAGG + Intergenic
995939788 5:117567873-117567895 GTCAACTGTGGGACTTGAGTGGG - Intergenic
998867128 5:146516583-146516605 GGATCCAGTGGGTCTGGAGTAGG + Intergenic
1002064132 5:176643745-176643767 GTCCCCAGTGGGGCTAGAGTTGG + Intronic
1003807108 6:9737524-9737546 TTCTTCTGTGGGTCTTGCCTGGG - Intronic
1004489989 6:16105404-16105426 GTGGCCTGTGGGTCGTGGGTTGG - Intergenic
1006337267 6:33427361-33427383 GTCTCCCGTGTGTTTTGGGTGGG + Intronic
1006660114 6:35634440-35634462 TTCTCCTTTGGGTCTTTAGTAGG - Intronic
1007273887 6:40659385-40659407 TTTTCCTGTGTGCCTTGAGTTGG - Intergenic
1007545246 6:42688352-42688374 TACTCCTGTGGCTCTGGAGTGGG + Exonic
1009002644 6:57737830-57737852 GTCTTCTATGGGTCTATAGTTGG + Intergenic
1010600931 6:77825487-77825509 GTCTCCTGTGGGCTTGGAGATGG - Intronic
1015108980 6:129569648-129569670 GACTCCTGTGCCTCTTGACTGGG + Intergenic
1017518922 6:155184526-155184548 GTCTCCTGTGGAGCTTGACCCGG - Intronic
1020034695 7:4958021-4958043 GGCTCCAGTGGGTGGTGAGTGGG - Intronic
1023271260 7:38465357-38465379 GGCTCCTGTGGGACTTTTGTAGG + Intronic
1024477396 7:49828577-49828599 GTATCCTGTGTGTGTTGAGCTGG + Intronic
1024627072 7:51217001-51217023 GCCTCCAGTGGGTCTTTGGTGGG - Intronic
1024927884 7:54636933-54636955 GGCACCTGTAGGACTTGAGTAGG + Intergenic
1026569860 7:71520156-71520178 GTCTCATGGGGGCCTAGAGTTGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033636615 7:143217960-143217982 ATCTCATGTGAGTCTTGAGGAGG - Intergenic
1035315725 7:157996867-157996889 GTCTCCTGAGGGCCTGGCGTGGG - Intronic
1035813712 8:2515328-2515350 GTCTCTTGTGGGGAATGAGTGGG + Intergenic
1037838495 8:22228373-22228395 GTCTCCTGTGGGGACTGAGGAGG + Exonic
1039395806 8:37224229-37224251 GTCACCTGTGTCTCTTGGGTAGG - Intergenic
1040662584 8:49593393-49593415 GTCTTATTTGGGTCTTGATTTGG - Intergenic
1041106663 8:54451344-54451366 ATCTGCAGTGGGTCTAGAGTAGG + Intergenic
1041976606 8:63805898-63805920 GTGTGCTGTGGGTGTTTAGTAGG + Intergenic
1042792600 8:72625026-72625048 GTCTCCTATGGGGCTTGACTGGG - Intronic
1042852537 8:73230379-73230401 GACTCTTGTAGGTCTGGAGTGGG - Intergenic
1043417324 8:80064332-80064354 TTCTCCAGCAGGTCTTGAGTAGG - Intronic
1044350250 8:91156427-91156449 GTTTCCTTTTGCTCTTGAGTTGG + Intronic
1044725428 8:95190896-95190918 GTCTCCTGTGTCTCCTGAGCAGG + Intergenic
1046383598 8:113480764-113480786 GTCCACTGAGGGTCCTGAGTTGG + Intergenic
1047229209 8:122981613-122981635 ATCTGCTGTGGGTGTGGAGTGGG - Intergenic
1047281901 8:123453137-123453159 GCATCCTGTGGGCCTTGAGTGGG - Intronic
1048548235 8:135406685-135406707 GCCTCCTGTGGGTGGTGTGTAGG - Intergenic
1051318228 9:15867035-15867057 TTCTCCTCTAGGTCTTGATTAGG - Intronic
1053163372 9:35828842-35828864 GTCTCCTGAGGGGCTTGCATTGG + Intronic
1054459739 9:65456217-65456239 TCCTCCTGGGGGTGTTGAGTGGG + Intergenic
1056113791 9:83422260-83422282 GTCTCTTGAGGGTCTTCAGGAGG - Intronic
1056438713 9:86598525-86598547 GTCCTCTGTGGGTGTGGAGTAGG - Intergenic
1060820827 9:126660834-126660856 GCCTACTGTGGTTCTTGGGTTGG + Intronic
1062539467 9:137035211-137035233 GTCTGCTCTTGGTCTGGAGTGGG - Exonic
1185706691 X:2272783-2272805 GTCTCCTGTGGGGCTGCAGCTGG - Intronic
1188751778 X:33913392-33913414 TTCTCCTGTAGTTGTTGAGTTGG - Intergenic
1189299995 X:39945501-39945523 GTCTCATGGGGGCCCTGAGTGGG - Intergenic
1190776516 X:53556483-53556505 GTCTCCTTTCGCACTTGAGTTGG - Intronic
1192464980 X:71348326-71348348 GCCTCCCGGGCGTCTTGAGTTGG - Intergenic
1194286692 X:92019947-92019969 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1194416066 X:93613434-93613456 CTCTCCAGTGAGTCTTGATTTGG + Intergenic
1196881948 X:120206655-120206677 GTCTCCTGTGAGTATGGAGAAGG + Intergenic
1199447631 X:147944354-147944376 GTCTCTTGTGGGTCATGGATTGG - Intronic
1199697922 X:150356689-150356711 TTCCCATGTGGGTCCTGAGTTGG + Intergenic
1200604238 Y:5244507-5244529 GCCTCATGTGGCTCTTGGGTGGG - Intronic