ID: 1100439700

View in Genome Browser
Species Human (GRCh38)
Location 12:94605194-94605216
Sequence GAAGCCAGGAATTTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1551
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 1467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100439698_1100439700 -8 Left 1100439698 12:94605179-94605201 CCATGCAGACAAGGGGAAGCCAG 0: 1
1: 0
2: 2
3: 28
4: 300
Right 1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG 0: 1
1: 0
2: 2
3: 81
4: 1467
1100439697_1100439700 -3 Left 1100439697 12:94605174-94605196 CCTGACCATGCAGACAAGGGGAA 0: 1
1: 0
2: 0
3: 23
4: 199
Right 1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG 0: 1
1: 0
2: 2
3: 81
4: 1467
1100439693_1100439700 14 Left 1100439693 12:94605157-94605179 CCATGCTAGGCTAGACACCTGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG 0: 1
1: 0
2: 2
3: 81
4: 1467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100439700 Original CRISPR GAAGCCAGGAATTTTAAAGC AGG Intronic
900016615 1:154984-155006 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900046876 1:513576-513598 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900069080 1:755294-755316 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900748880 1:4381205-4381227 AAAGAGAGGAATTTTACAGCTGG + Intergenic
900797328 1:4716287-4716309 GAAGCCAGGAATTTGAAGACAGG - Intronic
900797686 1:4719186-4719208 GAAGCCAGACATTCTAAAACTGG - Intronic
900936079 1:5766963-5766985 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
900939625 1:5790132-5790154 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
901495585 1:9619537-9619559 GAAACCAGGAATTTGAGACCAGG + Intergenic
902059754 1:13632202-13632224 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
902231568 1:15030855-15030877 GGAGCCAGGAAGCTCAAAGCTGG + Intronic
902450837 1:16496070-16496092 GGTGCCAGGAGTGTTAAAGCAGG - Intergenic
902502030 1:16917269-16917291 GGTGCCAGGAGTGTTAAAGCAGG + Intronic
902964612 1:19990591-19990613 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
903752574 1:25635939-25635961 CAAGAGAGGAATTTTACAGCCGG + Intronic
904714793 1:32459364-32459386 AAAGAGAGGAATTTTACAGCTGG - Intergenic
904893536 1:33797302-33797324 AAAGAGAGGAATTTTACAGCTGG - Intronic
904989694 1:34582006-34582028 TTAGCCAGGAATTCTAAAGAGGG + Intergenic
905135191 1:35793995-35794017 GAAGCCAGGAGTTTCAGACCAGG - Intergenic
905535089 1:38715054-38715076 GAAGCCTGGAATTTGAATCCAGG + Intergenic
906116197 1:43358961-43358983 TAAGCCAGGCGTGTTAAAGCCGG + Intronic
906183396 1:43840693-43840715 AAAGAGAGAAATTTTAAAGCTGG - Intronic
906333754 1:44910200-44910222 TAAAGCAGGAATTTTAGAGCTGG + Intronic
906352628 1:45077325-45077347 AAAGAGAGAAATTTTAAAGCTGG + Intronic
906410802 1:45577368-45577390 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
906417902 1:45636139-45636161 GAAGACAGGTTTTTTAGAGCTGG - Intronic
906448888 1:45927006-45927028 AAAGAGAGAAATTTTAAAGCTGG + Intronic
906623834 1:47308273-47308295 AAAGAGAGAAATTTTAAAGCTGG - Intronic
906840534 1:49134037-49134059 AAAGAGAGAAATTTTAAAGCTGG + Intronic
907506677 1:54924132-54924154 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
907887702 1:58608593-58608615 GAAGCCAGGAAATTTAGGGCTGG - Intergenic
907995041 1:59622250-59622272 GAAGATAAGAATTTTAAAGTAGG - Intronic
908019780 1:59887647-59887669 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
908045240 1:60161617-60161639 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
908111095 1:60898237-60898259 GAATCCTGGAATTTTGAATCAGG - Intronic
908326941 1:63032226-63032248 ACAGCCAGGCATTTTAAAGAGGG - Intergenic
908761290 1:67514282-67514304 AAAGAGAGGAATTTTACAGCTGG - Intergenic
909082790 1:71134240-71134262 AAAGAGAGGAATTTTACAGCTGG + Intergenic
909254973 1:73408276-73408298 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909352520 1:74671496-74671518 AAAGAGAGGAATTTTACAGCTGG - Intronic
909382749 1:75018546-75018568 GAATCCTAGAATTTTAAAGCTGG + Intergenic
909464853 1:75961595-75961617 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909556506 1:76960216-76960238 AAAGAGAGAAATTTTAAAGCTGG + Intronic
909577312 1:77188745-77188767 AAAGAGAGAAATTTTAAAGCTGG - Intronic
909578541 1:77204626-77204648 AAAGGGAGAAATTTTAAAGCTGG - Intronic
909749320 1:79138679-79138701 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909812847 1:79953283-79953305 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
910162421 1:84287983-84288005 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
910493572 1:87800197-87800219 GAAGCCTGGAATTTAAACACTGG + Intergenic
910605641 1:89080625-89080647 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
910638832 1:89438872-89438894 AAAGAGAGGAATTTTACAGCTGG - Intergenic
910833481 1:91483894-91483916 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911030170 1:93479109-93479131 AAAGAGAGGAATTTTACAGCTGG + Intronic
911083006 1:93951774-93951796 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911153603 1:94618648-94618670 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911487915 1:98525777-98525799 AAAGAGAGGAATTTTACAGCTGG + Intergenic
911592023 1:99759300-99759322 AAAGACAGGAATTTTACAGCTGG - Intronic
911803581 1:102176255-102176277 GATGCCAGGAGTTTGAAATCAGG - Intergenic
911831370 1:102554505-102554527 AAAGAAAGGAATTTTACAGCTGG - Intergenic
911893728 1:103403532-103403554 AAAGACAGAAATTTTAAAGCTGG - Intergenic
911896048 1:103436480-103436502 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911940747 1:104044616-104044638 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
912010123 1:104948623-104948645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912097390 1:106161947-106161969 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
912112306 1:106358299-106358321 CAAGAGAGGAATTTTACAGCTGG + Intergenic
912303510 1:108540921-108540943 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912441636 1:109703533-109703555 AAAGAGAGGAATTTTACAGCTGG - Intronic
912442426 1:109709536-109709558 AAAGAGAGGAATTTTACAGCTGG - Intronic
912807211 1:112766594-112766616 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912851054 1:113124945-113124967 GAGGCCAGGAATTTGAGACCAGG + Exonic
912854931 1:113159196-113159218 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912951636 1:114124388-114124410 GAAGTCAGGCAATTTAAAGAGGG + Intronic
913355947 1:117922561-117922583 AAAGAGAGAAATTTTAAAGCTGG + Intronic
915097348 1:153472677-153472699 CAAGAGAGGAATTTTACAGCTGG - Intergenic
915448460 1:155988558-155988580 AAAGAGAGAAATTTTAAAGCTGG - Intronic
915749536 1:158193211-158193233 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
915999470 1:160600908-160600930 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
916302337 1:163289965-163289987 GAAGCCAGGAATATTCAACATGG + Intronic
916318957 1:163481122-163481144 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
916626866 1:166567590-166567612 AAAGACAGAAATTTTAAAGCTGG + Intergenic
917278108 1:173352435-173352457 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
917313000 1:173696172-173696194 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
917588427 1:176452270-176452292 AAAGAGAGGAATTTTACAGCTGG - Intergenic
917765240 1:178208851-178208873 AAAGAGAGGAATTTTACAGCTGG - Intronic
917821118 1:178765314-178765336 GAAGAGAGAAATTTTAAAGCTGG + Intronic
918086135 1:181246969-181246991 AAAGAGAGGAATTTTACAGCTGG - Intergenic
918087113 1:181255124-181255146 AAAGAGAGGAATTTTACAGCTGG - Intergenic
918106549 1:181420135-181420157 GGAGACAGGATTTGTAAAGCTGG - Intronic
918175939 1:182045331-182045353 AAAGAGAGGAATTTTACAGCTGG + Intergenic
918453178 1:184680634-184680656 AAAGAGAGGAATTTTACAGCTGG + Intergenic
918532516 1:185538904-185538926 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
918536327 1:185578872-185578894 AAAGAGAGGAATTTTACAGCTGG - Intergenic
918600156 1:186348673-186348695 AAAGAGAGGAATTTTACAGCTGG - Intronic
918847991 1:189643988-189644010 AAAGAGAGGAATTTTACAGCTGG + Intergenic
918977866 1:191513727-191513749 AAAGAGAGGAATTTTACAGCTGG - Intergenic
919025643 1:192165558-192165580 AAAGAGAGAAATTTTAAAGCTGG - Intronic
919035806 1:192308035-192308057 AAAGAGAGGAATTTTACAGCTGG + Intergenic
919110019 1:193207082-193207104 AAAGAGAGGAATTTTACAGCTGG + Intronic
919189939 1:194203594-194203616 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919296066 1:195702281-195702303 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919318514 1:196004361-196004383 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919383326 1:196886396-196886418 AAAGAGAGAAATTTTAAAGCTGG + Intronic
919670974 1:200337734-200337756 GAAGCCTGGAATTTGAACCCAGG - Intergenic
920062266 1:203235483-203235505 AAAGAGAGAAATTTTAAAGCTGG - Intronic
920879611 1:209867544-209867566 AAAGAGAGGAATTTTACAGCTGG - Intergenic
920908957 1:210196157-210196179 AAAGAGAGGAATTTTACAGCTGG + Intergenic
921788110 1:219257483-219257505 AAAGAGAGGAATTTTACAGCTGG + Intergenic
922104440 1:222500687-222500709 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922264760 1:223973201-223973223 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922376278 1:224970585-224970607 AAAGAGAGAAATTTTAAAGCTGG - Intronic
922694658 1:227723233-227723255 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922829124 1:228542187-228542209 GATCCCAGGAATTTTAATGATGG - Intergenic
922967964 1:229707667-229707689 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
923327336 1:232892357-232892379 GAAGCCTGGAATTTTAATGTTGG - Intergenic
923419547 1:233798939-233798961 AAAGGCAGAAATTTTAAAGTTGG + Intergenic
923874306 1:238030854-238030876 GAATCTATGAATTTGAAAGCAGG + Intergenic
924120234 1:240789983-240790005 AAAGAGAGAAATTTTAAAGCTGG - Intronic
924251906 1:242141298-242141320 GGAGCCTGGCATTTTACAGCGGG - Intronic
924296974 1:242597453-242597475 AAAGAGAGGAATTTTACAGCTGG - Intergenic
924346619 1:243078205-243078227 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
924358998 1:243215884-243215906 AAAGAGAGAAATTTTAAAGCTGG - Intronic
924489971 1:244526836-244526858 AAAGAGAGAAATTTTAAAGCTGG + Intronic
924728958 1:246694809-246694831 AAAGAGAGGAATTTTATAGCTGG - Intergenic
924834735 1:247636921-247636943 GATGCCAGGAATTTAAGACCAGG - Intergenic
924869670 1:248027557-248027579 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1063626904 10:7698739-7698761 GAGGCCAGGAATTTGAGACCTGG - Intergenic
1064214550 10:13388796-13388818 GAAGCCAGGAATATTTAAAGAGG - Intergenic
1064626124 10:17263380-17263402 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1064779003 10:18812632-18812654 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1065002759 10:21352050-21352072 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1065125064 10:22566241-22566263 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1065432559 10:25674208-25674230 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1065499715 10:26367532-26367554 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1065512420 10:26492589-26492611 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1065725909 10:28667852-28667874 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1065936263 10:30523102-30523124 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066203733 10:33166585-33166607 GAGGCAAGGAATTACAAAGCTGG + Intergenic
1066257124 10:33690786-33690808 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1066331450 10:34427741-34427763 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1066407798 10:35135674-35135696 GAAGCTAGGAATTTGAGACCTGG + Intronic
1066621337 10:37354461-37354483 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1066642306 10:37566828-37566850 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066651100 10:37655922-37655944 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1066664027 10:37764613-37764635 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066671412 10:37844239-37844261 CCAGCCAGGAATTGTAAACCTGG + Intronic
1066686041 10:37982589-37982611 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1066729732 10:38426644-38426666 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1067013931 10:42741287-42741309 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1067128257 10:43538840-43538862 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1067303010 10:45031696-45031718 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1067403491 10:45999424-45999446 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1067492395 10:46723278-46723300 AAAAACGGGAATTTTAAAGCTGG - Intergenic
1067542996 10:47170080-47170102 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1067602270 10:47617104-47617126 AAAAACGGGAATTTTAAAGCTGG + Intergenic
1067920106 10:50446349-50446371 AAAGGGAGAAATTTTAAAGCTGG - Intronic
1068290808 10:54999815-54999837 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1068423360 10:56823602-56823624 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1068662536 10:59637421-59637443 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1068784187 10:60952168-60952190 CAAAGCTGGAATTTTAAAGCTGG + Intronic
1069094451 10:64241575-64241597 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1069132828 10:64727762-64727784 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1069185223 10:65414192-65414214 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1069198476 10:65583441-65583463 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1069203936 10:65658347-65658369 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1069569979 10:69488600-69488622 AAAGAGAGGAATTTTACAGCTGG + Intronic
1069650285 10:70042344-70042366 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1069675385 10:70243081-70243103 TAAGACAGGAACTTTAAGGCAGG + Intergenic
1069812873 10:71175383-71175405 AAAGCTAGGAATTCTTAAGCTGG + Intergenic
1069912617 10:71768691-71768713 GAAGCCAGGAGTTTCAAGCCAGG - Intronic
1070050376 10:72882905-72882927 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1070314778 10:75299690-75299712 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1070463277 10:76691241-76691263 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1070482399 10:76895765-76895787 AAAGGGAGAAATTTTAAAGCTGG + Intronic
1070582973 10:77737198-77737220 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1070945224 10:80385421-80385443 GAAGCCAGGAATTGGAGACCAGG - Intergenic
1071049510 10:81429590-81429612 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1071183958 10:83019361-83019383 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071189404 10:83082239-83082261 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071283529 10:84124430-84124452 GAAGTCTGGAATTTTAAAAAAGG - Intergenic
1071412540 10:85411064-85411086 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1071588952 10:86853638-86853660 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1071599679 10:86952488-86952510 AAAGAGAGGAATTTTACAGCTGG + Intronic
1072128324 10:92467284-92467306 GAAGCCAGGAATTTGAGATTAGG - Intronic
1072323275 10:94271819-94271841 AAAGAGAGGAATTTTACAGCTGG + Intronic
1072387243 10:94943521-94943543 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1072473116 10:95732709-95732731 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1072498369 10:95986248-95986270 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1072565299 10:96612030-96612052 GAAGTCATGAAGTTTAAAGGAGG - Intronic
1072604412 10:96967343-96967365 GAAGCCAGGAGTTCCAAAACAGG - Intronic
1073046341 10:100641094-100641116 GAGGCCAGGAATTTGAGACCAGG + Intergenic
1073353862 10:102838192-102838214 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1073569088 10:104560764-104560786 GAACTCAGGTATTTAAAAGCAGG + Intergenic
1073678637 10:105678148-105678170 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1073990799 10:109260610-109260632 GAAGCAAGAAATATTAGAGCTGG + Intergenic
1074211704 10:111341247-111341269 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1074271419 10:111957426-111957448 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1074594641 10:114850490-114850512 GAAGCCAGAAATTTGAGACCAGG + Intronic
1074624920 10:115172278-115172300 AAAGCCAGGCAATTTAAAGGAGG - Intronic
1074646582 10:115459853-115459875 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1074716628 10:116225800-116225822 GAAGCCAGGAGTTTGAGACCAGG - Intronic
1074863124 10:117528180-117528202 GGGGAAAGGAATTTTAAAGCAGG - Intergenic
1074983776 10:118640103-118640125 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1075997657 10:126891599-126891621 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1076055523 10:127369138-127369160 GAAGCCAGTAATTGAATAGCCGG + Intronic
1076973206 11:150053-150075 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1077594540 11:3520449-3520471 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1077851369 11:6077018-6077040 CAAGAGAGAAATTTTAAAGCTGG - Intergenic
1078231971 11:9451826-9451848 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1078572326 11:12469904-12469926 GAAGCCAGGACTCCTAAAGGTGG - Intronic
1078804501 11:14684268-14684290 AAAGAGAGGAATTTTACAGCTGG + Intronic
1078839266 11:15063061-15063083 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1078840000 11:15069559-15069581 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1079586055 11:22127968-22127990 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1079666859 11:23116894-23116916 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1079877633 11:25879331-25879353 AAAGACAGCAATTTCAAAGCTGG - Intergenic
1080203703 11:29705310-29705332 AAAGGGAGAAATTTTAAAGCTGG - Intergenic
1080859725 11:36142735-36142757 GCAGCCAGGCATTTTCAAGCAGG + Intronic
1080935854 11:36862650-36862672 GAAGCCAGTGGTTTTAAAGCAGG - Intergenic
1081007090 11:37758044-37758066 GAGGCCAGGAATTTGAGACCAGG + Intergenic
1081009874 11:37797848-37797870 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1081140626 11:39494288-39494310 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1081461191 11:43274298-43274320 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082062893 11:47875606-47875628 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1082282199 11:50281871-50281893 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1082300102 11:50494658-50494680 CAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082309464 11:50629600-50629622 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082310197 11:50636598-50636620 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082572350 11:54759188-54759210 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1082780242 11:57281862-57281884 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082919242 11:58474217-58474239 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1083092810 11:60218504-60218526 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1083291836 11:61694902-61694924 GAAGCCTGGAAGATAAAAGCTGG + Intronic
1084097964 11:66924925-66924947 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1084250386 11:67893720-67893742 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1084822393 11:71701622-71701644 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1085480167 11:76815477-76815499 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1085939088 11:81186814-81186836 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1085959421 11:81443206-81443228 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1086261828 11:84949114-84949136 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1086667826 11:89505676-89505698 GAAAACAGGAATCTTAGAGCTGG + Intergenic
1086930514 11:92687986-92688008 GAGGCCAGGAATTTGAGACCAGG + Intronic
1086943357 11:92820719-92820741 GAATCCAGGCATTTTTTAGCTGG - Intronic
1087394098 11:97574325-97574347 CAAGAGAGAAATTTTAAAGCTGG - Intergenic
1087410488 11:97784975-97784997 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1087680177 11:101211295-101211317 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1087742070 11:101899311-101899333 GAGGCCAGGAGTTTGAAACCAGG - Intronic
1088008741 11:104973500-104973522 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1088087939 11:106003676-106003698 AAAGTGAGAAATTTTAAAGCTGG - Intronic
1088380505 11:109187652-109187674 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088458086 11:110053644-110053666 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088494727 11:110421459-110421481 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088562463 11:111129524-111129546 GAAACCAGGAATTTTGACTCGGG + Intergenic
1088595252 11:111436278-111436300 AAAGCCAGGAGTTACAAAGCTGG - Intronic
1088699342 11:112398017-112398039 TAAGCCTGGAAATTTAGAGCTGG - Intergenic
1088967207 11:114735946-114735968 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1089346355 11:117794204-117794226 GAAAACAGGAATTTTAGTGCCGG + Intronic
1089574829 11:119434521-119434543 GAGGCCAGGAGTTTGAAACCAGG - Intergenic
1089850838 11:121495160-121495182 GAAGCCTGGAAGTTTGAGGCTGG - Intronic
1089858695 11:121569919-121569941 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1090068345 11:123522980-123523002 CAAGCCTGGAATTTGAATGCAGG - Intergenic
1090079878 11:123605091-123605113 GCAGCCAGGAATTTTACATGGGG + Intronic
1090222926 11:125046253-125046275 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1091410524 12:236353-236375 AAAGAGAGGAATTTTACAGCTGG - Intronic
1091536311 12:1413378-1413400 GAAGCCAGGAGTTTGAGACCAGG + Intronic
1092334478 12:7617601-7617623 GAATCATGGAATTTTAAAGCAGG + Intergenic
1092414535 12:8280156-8280178 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1092420715 12:8329238-8329260 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1092530049 12:9336419-9336441 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1092636615 12:10457836-10457858 GAAGCCAGGCATTTTCAACCTGG + Intergenic
1092678144 12:10945379-10945401 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1092852204 12:12639754-12639776 AAAGAGAGGAATTTTACAGCTGG + Intronic
1092900285 12:13053457-13053479 AAAGAGAGGAATTTTATAGCTGG + Intronic
1093074680 12:14745733-14745755 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1093729801 12:22554552-22554574 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1094328645 12:29268782-29268804 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1094377060 12:29801614-29801636 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094385018 12:29884868-29884890 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094411794 12:30174620-30174642 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094416626 12:30222920-30222942 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094453320 12:30604539-30604561 GAAGCCAGGAAGTTTGAACTGGG + Intergenic
1094578307 12:31708709-31708731 AAAGAGAGGAATTTTACAGCTGG - Intronic
1094605936 12:31949208-31949230 AAAGAGAGGAATTTTATAGCTGG - Intergenic
1094720324 12:33056295-33056317 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094860512 12:34461171-34461193 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094866009 12:34530640-34530662 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1095252969 12:39999942-39999964 AAAGAGAGGAATTTTACAGCTGG - Intronic
1095481179 12:42637600-42637622 GAAGCCAGGAGTTTGAGACCAGG - Intergenic
1095585796 12:43847904-43847926 AAAGAGAGGAATTTTACAGCTGG + Intronic
1095920815 12:47528029-47528051 GAGGCCAGGCATTTGAGAGCAGG - Intergenic
1096383973 12:51182309-51182331 GAAGCCAGGATTTTTATTGTGGG - Intergenic
1096431205 12:51544633-51544655 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1096948731 12:55441037-55441059 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1097110480 12:56654365-56654387 AAAGAGAGCAATTTTAAAGCTGG - Intergenic
1097333909 12:58361038-58361060 GAAGCCATGAATTTGAAAACAGG + Intergenic
1097664460 12:62463836-62463858 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1097927634 12:65147552-65147574 GAGGCCAAGAATTTATAAGCAGG + Intergenic
1098001969 12:65954338-65954360 TAAGGCAGGAATTTTTTAGCTGG + Intronic
1098333724 12:69380784-69380806 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1098459334 12:70715143-70715165 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1098467871 12:70808504-70808526 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1098741112 12:74174838-74174860 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1098781114 12:74687687-74687709 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1098960608 12:76736125-76736147 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1099117806 12:78649195-78649217 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1099318811 12:81119068-81119090 AAAGAGAGGAATTTTACAGCCGG + Intronic
1099672250 12:85709493-85709515 GAAGCCAGCAATTTTCCAGAGGG + Intergenic
1099721269 12:86364679-86364701 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1099724539 12:86409894-86409916 AAAGAGAGGAATTTTACAGCTGG + Intronic
1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG + Intronic
1100439842 12:94606645-94606667 AAAGAGAGGAATTTTACAGCTGG + Intronic
1100508936 12:95249477-95249499 GCTGCCAGAAATTTTAAATCTGG + Intronic
1100970626 12:100065989-100066011 AAAGAGAGGAATTTTACAGCTGG - Intronic
1101088091 12:101256658-101256680 GAAGGAAGGGATTTTAAAGGGGG + Intergenic
1101500560 12:105300187-105300209 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1101502168 12:105314330-105314352 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1101543379 12:105685120-105685142 GCTGCCAGGAAATATAAAGCAGG + Intergenic
1101644683 12:106620334-106620356 AAAGAAAGGAATTTTACAGCTGG + Intronic
1101729491 12:107415137-107415159 GAAGCCAGCAATGTGAAAACAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102307967 12:111820823-111820845 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1102384851 12:112500028-112500050 GAGGCCAGGAATTTGAGACCAGG + Intronic
1103218041 12:119218687-119218709 GAAGACAGAAATTTTAAAGCTGG + Intronic
1103485659 12:121281094-121281116 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1103519477 12:121528343-121528365 GAGGCCAGGAATTTGAGACCAGG + Intronic
1104079314 12:125416374-125416396 GGAGCCAGAGGTTTTAAAGCAGG - Intronic
1104693254 12:130842409-130842431 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1105227608 13:18451090-18451112 AAAGATAGAAATTTTAAAGCTGG + Intergenic
1105244454 13:18636170-18636192 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1105249192 13:18681545-18681567 GAAGACAGGAATTTGAGATCTGG + Intergenic
1105897716 13:24731313-24731335 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1106610872 13:31279418-31279440 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1106746462 13:32713979-32714001 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1106961002 13:34998095-34998117 AAAGGGAGAAATTTTAAAGCTGG + Intronic
1107520450 13:41175410-41175432 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1107795842 13:44050905-44050927 TAAGCCAGGCATTTTAGACCAGG + Intergenic
1107907455 13:45074378-45074400 AAAGTGAGAAATTTTAAAGCCGG - Intergenic
1108294691 13:49002030-49002052 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1108519151 13:51230147-51230169 GAATCAATGAATTTTAAAACTGG - Intronic
1108960475 13:56221732-56221754 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1109081099 13:57902754-57902776 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1109255724 13:60078934-60078956 GAAGCCAGGATTAGAAAAGCAGG + Intronic
1109377658 13:61519027-61519049 AAAGACAGAAATTTTAAAGCTGG + Intergenic
1109514674 13:63426965-63426987 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1109586837 13:64415888-64415910 GCAGCCAGGAATTCATAAGCTGG + Intergenic
1109590675 13:64476576-64476598 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1109647230 13:65274423-65274445 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1109682605 13:65772297-65772319 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1109918061 13:69018004-69018026 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1109963416 13:69660770-69660792 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1110080072 13:71298603-71298625 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1110409049 13:75184150-75184172 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1110529154 13:76576206-76576228 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1110660675 13:78056641-78056663 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1110953719 13:81525531-81525553 AAAGACAGGAATTTTACAACTGG - Intergenic
1111011187 13:82317274-82317296 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1111429455 13:88133095-88133117 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1111452344 13:88435481-88435503 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1111468239 13:88644912-88644934 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1111509626 13:89243512-89243534 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1111684877 13:91489334-91489356 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1111712076 13:91829715-91829737 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1112093597 13:96108604-96108626 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1112094781 13:96120245-96120267 GAAACCAGGAATCTGAAACCAGG - Intronic
1112252297 13:97793307-97793329 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1112449281 13:99494357-99494379 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1112960522 13:105120105-105120127 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1113216183 13:108043183-108043205 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1113290130 13:108896653-108896675 GATGCCAGGAAATTTAAAAGTGG + Intronic
1113536556 13:111071252-111071274 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1114144314 14:19955598-19955620 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1114157238 14:20118600-20118622 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114215436 14:20654446-20654468 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114355588 14:21904285-21904307 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1114426832 14:22630922-22630944 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114638506 14:24202922-24202944 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1114687179 14:24544134-24544156 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1114750484 14:25199461-25199483 AAAGACAGGAATTTTACAGCTGG + Intergenic
1114753020 14:25227277-25227299 AAAGGGAGAAATTTTAAAGCTGG + Intergenic
1114867474 14:26614420-26614442 GAGGCCAGGAGTTTGAAACCAGG - Intergenic
1114892378 14:26941948-26941970 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1115152136 14:30297791-30297813 GAAGCACAGAATTTTAAAGCTGG + Intergenic
1115386508 14:32804346-32804368 AAAGGGAGGAATTTTACAGCTGG + Intronic
1115525956 14:34281031-34281053 AAAGAGAGGAATTTTACAGCTGG + Intronic
1115647615 14:35380583-35380605 GAAGCCAGGAATTCAAGACCAGG + Intergenic
1115688546 14:35821842-35821864 GATGACAGGAATTTTAGAGCTGG + Intergenic
1115810978 14:37106831-37106853 AAAGAGAGGAATTTTACAGCTGG - Intronic
1115884751 14:37958768-37958790 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1115886843 14:37981664-37981686 AAAGAGAGGAATTTAAAAGCTGG - Intronic
1115958746 14:38810809-38810831 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1116181332 14:41540484-41540506 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1116200707 14:41792072-41792094 AAAGGGAGGAATTTTACAGCTGG + Intronic
1116268215 14:42724242-42724264 GAAGCAAGGAAGCTTAAAGGGGG + Intergenic
1116301741 14:43192099-43192121 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1116554670 14:46288055-46288077 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1116562795 14:46402598-46402620 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1116689868 14:48091855-48091877 GAGGCCAGGAGTTTGAAACCAGG + Intergenic
1116795812 14:49389124-49389146 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1117098554 14:52322181-52322203 GAAGAGAGGAATTATACAGCTGG + Intronic
1117276464 14:54198888-54198910 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1117415896 14:55495123-55495145 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1118014986 14:61651258-61651280 GATGCCAGGTATTTTACAGTCGG + Intronic
1118031977 14:61826876-61826898 CAAGCCAGGAATATTAAAAGGGG - Intergenic
1118372144 14:65146430-65146452 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1118376122 14:65178730-65178752 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1119037644 14:71244141-71244163 GAAGCACGGAATTTAAGAGCTGG + Intergenic
1119101939 14:71888029-71888051 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1119573304 14:75695603-75695625 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1119959789 14:78842302-78842324 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1120130421 14:80800152-80800174 AAAGAGAGGAATTTTACAGCTGG - Intronic
1120200976 14:81538007-81538029 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1120397151 14:83982322-83982344 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1120411003 14:84155479-84155501 GATGAAAGGAATTTTAAAGCAGG - Intergenic
1120807338 14:88766809-88766831 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1121027729 14:90628770-90628792 GAAGGCAGGAAATGTAAAACAGG - Intronic
1121051810 14:90824104-90824126 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1121064964 14:90954105-90954127 AAAGAGAGGAATTTTACAGCTGG - Intronic
1121080396 14:91103277-91103299 GAGGCCAGGAATTTGAAATGAGG - Intronic
1121099395 14:91239834-91239856 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1121122133 14:91382791-91382813 AAAGCAGAGAATTTTAAAGCGGG - Intronic
1121399058 14:93655961-93655983 GAAGCCAATACTGTTAAAGCTGG + Intronic
1121793363 14:96715794-96715816 GAAGCCAGGAGTTTGAGACCAGG - Intergenic
1122844203 14:104481830-104481852 AAAGAGAGGAATTTTACAGCTGG + Intronic
1123212928 14:106778022-106778044 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1123690314 15:22833253-22833275 AAAGGGAGAAATTTTAAAGCTGG + Intergenic
1123845514 15:24297242-24297264 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123849009 15:24334765-24334787 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123864558 15:24505032-24505054 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123872076 15:24585964-24585986 GAAGCCAGGACTTGGAAACCAGG - Intergenic
1123931536 15:25173966-25173988 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1124066465 15:26348480-26348502 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1124248151 15:28088591-28088613 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1124291875 15:28459176-28459198 CAAGCCATGAATTTTAACACTGG + Intergenic
1125004998 15:34807159-34807181 GAAGAGAGGAATTTTACAGCTGG + Intergenic
1125567274 15:40686154-40686176 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1125874120 15:43129031-43129053 AAAGAGAGGAATTTTACAGCTGG - Intronic
1126142958 15:45452505-45452527 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1126276120 15:46883653-46883675 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1126418081 15:48440010-48440032 GGAGCCAGGAAATTGAGAGCTGG - Intronic
1126971668 15:54120153-54120175 GACACCAGGACTTTTAAAGCTGG + Intronic
1127018906 15:54722934-54722956 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1127072248 15:55298328-55298350 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1127092415 15:55480229-55480251 AAAGAGAGGAATTTTACAGCTGG - Intronic
1127182969 15:56443274-56443296 AAAGACAGAAATTTTCAAGCTGG - Intronic
1127755059 15:62084150-62084172 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1127926652 15:63550941-63550963 GAGGCCAGGAATTTGAGACCAGG + Intronic
1128477234 15:68007648-68007670 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1128598751 15:68977211-68977233 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1128900218 15:71413889-71413911 GAAGCAGGGAACATTAAAGCTGG - Intronic
1129043289 15:72709221-72709243 GAAGAGAGGAATTTCACAGCTGG - Intronic
1129218712 15:74118148-74118170 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1129636710 15:77326359-77326381 AAAGCCAGAAATTTTAAATTAGG + Intronic
1129969114 15:79761834-79761856 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1130088057 15:80795201-80795223 GAAGACATGAAATTTCAAGCAGG + Intronic
1130306772 15:82717155-82717177 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1130757245 15:86778046-86778068 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1131589741 15:93735567-93735589 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1131723358 15:95196014-95196036 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1131855479 15:96588919-96588941 CAAGCCAAGAATTTTAGAGTTGG + Intergenic
1132166586 15:99597716-99597738 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1132213769 15:100047481-100047503 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1132266355 15:100474845-100474867 GAAGCCAGGAATTCAAACCCAGG + Intronic
1132424649 15:101704807-101704829 GAAGCCAGAAATTTAAAACTTGG + Intronic
1132504462 16:300411-300433 GAGGCCAGGAATTTAAGAGCAGG - Intronic
1133162118 16:3919001-3919023 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1133423553 16:5667754-5667776 CAAGCCAGGAATTTCAAAGTAGG + Intergenic
1134167968 16:11945458-11945480 GAGGCCAGGAATTTGAGACCAGG + Intronic
1134406520 16:13964272-13964294 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1135202875 16:20454178-20454200 AAAGACAGAAATTTTACAGCTGG - Intronic
1135216222 16:20573688-20573710 AAAGACAGAAATTTTACAGCTGG + Intronic
1135301190 16:21328850-21328872 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1135540517 16:23326679-23326701 GAGGCCAGGAGTTTGAAACCAGG - Intronic
1135593543 16:23723211-23723233 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1135813460 16:25610671-25610693 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
1136095551 16:27953301-27953323 GAAGCCAGAAATTTGAGACCAGG - Intronic
1136361595 16:29783936-29783958 AAAGATAGGAATTTTACAGCTGG - Intergenic
1136595376 16:31245446-31245468 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1136635311 16:31517707-31517729 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1136642552 16:31579034-31579056 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1136653451 16:31693520-31693542 GAAGCCAGGGATTTTCTAGAGGG - Intergenic
1136726241 16:32359865-32359887 GAAGCAAGGAATTTAAAAGGGGG + Intergenic
1136925396 16:34367599-34367621 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1136979178 16:35044207-35044229 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1137335095 16:47540571-47540593 AAAGAGAGGAATTTTACAGCTGG - Intronic
1137414619 16:48263888-48263910 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1137498046 16:48986107-48986129 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1138034733 16:53592968-53592990 GAAGCCCAGAAGTTTAAGGCAGG - Intergenic
1138373948 16:56549576-56549598 GAATCAAGGAATTGTACAGCAGG - Intergenic
1138500558 16:57440510-57440532 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1139497940 16:67334815-67334837 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1139624390 16:68173933-68173955 GAAGCCAGGAGTTTGAGACCAGG + Intronic
1139904535 16:70354727-70354749 GAGGCCAGGAATTTGAGAACAGG + Intronic
1139946999 16:70648340-70648362 GAGGCCAGGAGTTTGAAACCAGG + Intronic
1140060106 16:71561731-71561753 AAAGAGAGGAATTTTACAGCTGG + Intronic
1140339199 16:74140430-74140452 CATGCCTGGAATTTTAATGCAGG + Intergenic
1140573621 16:76137947-76137969 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1141275465 16:82583761-82583783 GAAGCCATGAATATTAAGGAAGG + Intergenic
1141347245 16:83258327-83258349 GGAACCAGGACTGTTAAAGCAGG - Intronic
1142447045 16:90147473-90147495 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1203000191 16_KI270728v1_random:157891-157913 GAAGCAAGGAATTTAAAAGGGGG - Intergenic
1203131792 16_KI270728v1_random:1694294-1694316 GAAGCAAGGAATTTAAAAGGGGG - Intergenic
1142460447 17:87858-87880 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1142936175 17:3333582-3333604 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1143941052 17:10541743-10541765 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1144177352 17:12720040-12720062 GAAGCCAGGAATATTGAAAATGG + Intronic
1145387485 17:22426421-22426443 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1145819609 17:27821908-27821930 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1145869594 17:28262687-28262709 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1146731894 17:35200181-35200203 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1147014511 17:37480611-37480633 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1147059000 17:37858957-37858979 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1147591441 17:41686300-41686322 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1149028239 17:52054660-52054682 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1149058175 17:52389764-52389786 CAAGCCAGGAATGTTAGAGCTGG + Intergenic
1149196463 17:54127426-54127448 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1149405771 17:56349371-56349393 GTAGCCACGAACTTAAAAGCTGG + Intronic
1149857166 17:60092877-60092899 AAAGAGAGGAATTTTACAGCAGG + Intergenic
1150358800 17:64510939-64510961 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1150447409 17:65237726-65237748 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1150608617 17:66715021-66715043 GGAGCAAGCAATTTGAAAGCAGG - Intronic
1151246638 17:72800006-72800028 AAAGAGAGGAATTTTACAGCTGG - Intronic
1151488396 17:74416848-74416870 GAAGCCAGGAGTTCAAGAGCAGG + Intergenic
1151591053 17:75045077-75045099 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1151864635 17:76792868-76792890 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1151937684 17:77273036-77273058 GAGGTCAGGAATTTGAGAGCAGG + Intergenic
1152415280 17:80156083-80156105 AAAGACAGAAATTTTACAGCTGG - Intergenic
1152988166 18:338167-338189 GATGCCAGGAATTTTGCAGAAGG - Intronic
1153795949 18:8622396-8622418 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1153889935 18:9503451-9503473 AAAGAGAGGAATTTTACAGCTGG - Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1154042231 18:10867180-10867202 GGATCCAGGAAATTTAAAGCTGG + Intronic
1154047688 18:10922240-10922262 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1154081722 18:11263883-11263905 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1154089252 18:11342265-11342287 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1154107571 18:11536064-11536086 AAAGAGAGAAATTTTAAAGCGGG + Intergenic
1154107588 18:11536187-11536209 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1154444481 18:14423732-14423754 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1154525774 18:15288386-15288408 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1155854563 18:30816451-30816473 AAAAACAGAAATTTTAAAGCTGG - Intergenic
1156173611 18:34516153-34516175 CAAGAGAGAAATTTTAAAGCTGG + Intronic
1156576161 18:38318397-38318419 GAGGCCAGGAGTTTGAGAGCAGG - Intergenic
1156649865 18:39213011-39213033 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1156883950 18:42112537-42112559 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1156921868 18:42531854-42531876 GAGGCCAGGAATTTAAGACCAGG + Intergenic
1157212224 18:45753352-45753374 GAAACCAGGAATTTCTAAGGAGG + Intergenic
1157467695 18:47961567-47961589 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1157706140 18:49808534-49808556 AAAGAGAGGAATTTTACAGCTGG + Intronic
1157756239 18:50220235-50220257 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1159074613 18:63666256-63666278 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1159240162 18:65732136-65732158 GAAAACAGGAATTTTAAACAAGG + Intergenic
1159280190 18:66274850-66274872 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1159549399 18:69878943-69878965 AAAGACAGAAATTTTAAAGCTGG + Intronic
1159686247 18:71424245-71424267 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1159996342 18:74969209-74969231 GCCGACAAGAATTTTAAAGCAGG - Intronic
1160132992 18:76246302-76246324 GATACCAGGAAGTTTAAAGGGGG - Intergenic
1160620132 18:80164717-80164739 AAAGAGAGGAATTTTACAGCTGG + Intronic
1160650162 19:220358-220380 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1160737314 19:669485-669507 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1162083333 19:8233093-8233115 GAGGCCAGGAATTTGAGACCAGG - Intronic
1162275411 19:9649944-9649966 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1162281067 19:9698406-9698428 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1162351519 19:10152884-10152906 GAAGCCAGGAGTTTGAGACCAGG + Intronic
1162370164 19:10273798-10273820 GAGGCCAGGAGTTTGAGAGCAGG + Intronic
1162689545 19:12417833-12417855 GAAGAGAGGAATTTTACAGCTGG - Intronic
1162858709 19:13489501-13489523 GAACCCAGGAGTTTGAGAGCAGG - Intronic
1163941603 19:20500313-20500335 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1163942595 19:20508808-20508830 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1164013481 19:21230516-21230538 AAAGACAGAAATTTTGAAGCTGG - Intronic
1164172175 19:22734857-22734879 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164276038 19:23719554-23719576 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164288654 19:23847410-23847432 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1164289773 19:23856707-23856729 AAAGGTAGGAATTTTACAGCTGG + Intergenic
1164365703 19:27579636-27579658 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164378684 19:27712327-27712349 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1164405838 19:27945221-27945243 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1165254921 19:34570698-34570720 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1165665468 19:37623676-37623698 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1165812825 19:38622332-38622354 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1165875235 19:39001885-39001907 GAAGCCAGGAGTTTGAGACCAGG + Intronic
1166079271 19:40433830-40433852 GGAGCCAGGAATTCAAAGGCTGG + Intergenic
1166165966 19:40988870-40988892 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1166426824 19:42686440-42686462 AAAGAGAGGAATTTTACAGCTGG + Intronic
1166654688 19:44602122-44602144 GAAGCCAGGTATGTTCAACCTGG + Intergenic
1166912109 19:46166253-46166275 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1167015963 19:46841406-46841428 GAAGCCTCGAAATTTAAAACAGG - Intronic
1167818816 19:51907667-51907689 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1167834531 19:52056895-52056917 AAAGAGAGGAATTTTACAGCTGG - Intronic
1168328605 19:55552458-55552480 GAGGCCAGGAATTCAAGAGCTGG + Intergenic
925350622 2:3198622-3198644 AAAGAGAGAAATTTTAAAGCTGG + Intronic
925393505 2:3515791-3515813 AAAGAGAGGAATTTTACAGCTGG - Intronic
925432194 2:3804396-3804418 GAAACTAGGAAATTAAAAGCAGG - Intronic
925974674 2:9133523-9133545 AAAGAGAGGAATTTTACAGCTGG + Intergenic
926426068 2:12739609-12739631 GAAGCAGGGAATGTTCAAGCAGG - Intronic
926556265 2:14361977-14361999 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926586455 2:14691237-14691259 AAAGAGAGGAATTTTACAGCTGG + Intergenic
926643129 2:15258968-15258990 AAAGAGAGGAATTTTACAGCTGG - Intronic
926816361 2:16801810-16801832 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
926859065 2:17290087-17290109 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926874128 2:17456559-17456581 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926909438 2:17837004-17837026 GAAGCCAGGAGTTCTAGACCTGG - Intergenic
926935993 2:18086940-18086962 GAAGCCAGGACATTTTAAGAGGG - Intronic
926996021 2:18736671-18736693 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
927195675 2:20544841-20544863 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
928508238 2:31976362-31976384 GAAGCCAGGAGTTCGAAACCAGG + Intronic
928708417 2:33977176-33977198 AAAGAGAGGAATTTTAAAGCTGG - Intergenic
928901624 2:36324160-36324182 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
929350264 2:40942227-40942249 AAAGAGAGGAATTTTACAGCTGG - Intergenic
929362687 2:41113511-41113533 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
929465448 2:42139876-42139898 GAAACCAGGGATTTTAAAATTGG - Intergenic
929468500 2:42168821-42168843 GAAGCAAGGAATTTTAGTGCTGG - Intergenic
929529557 2:42739202-42739224 AAAGAGAGAAATTTTAAAGCTGG - Intronic
930161896 2:48167035-48167057 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
930300717 2:49612216-49612238 AAAGAGAGGAATTTTACAGCTGG - Intergenic
930408994 2:50999554-50999576 AAAGAGAGAAATTTTAAAGCTGG - Intronic
930423236 2:51179366-51179388 AAAGAGAGGAATTTTACAGCTGG - Intergenic
930489573 2:52051195-52051217 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
930595853 2:53387300-53387322 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
930643543 2:53879040-53879062 AAAGAGAGGAATTTTAAAGCTGG - Intronic
930986933 2:57600757-57600779 GATGCAAGGTATATTAAAGCAGG + Intergenic
931114067 2:59145461-59145483 CAAGCCAGGAAATTTAAAAAGGG + Intergenic
931470429 2:62533650-62533672 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
931578545 2:63747001-63747023 AAAGAGAGAAATTTTAAAGCTGG - Intronic
932071898 2:68628950-68628972 AAAGAGAGGAATTTTACAGCTGG + Intronic
932139180 2:69260565-69260587 AAAGAGAGGAATTTTACAGCTGG - Intergenic
932175144 2:69593902-69593924 AAAGACAGAAATGTTAAAGCTGG - Intronic
932395633 2:71445490-71445512 AAAGAGAGGAATTTTACAGCTGG - Intergenic
932489605 2:72112305-72112327 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
932851011 2:75186891-75186913 GAAGCAAGGAATTTTTATCCAGG + Intronic
932881821 2:75508789-75508811 AAAGAGAGAAATTTTAAAGCTGG - Intronic
932941931 2:76177236-76177258 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
933611806 2:84444318-84444340 AAAGAGAGAAATTTTAAAGCTGG + Intronic
934753741 2:96810905-96810927 GAAGCCTGGAGTTTTGCAGCAGG - Exonic
934932258 2:98436171-98436193 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
935018372 2:99206023-99206045 AAAGAGAGAAATTTTAAAGCTGG - Intronic
935097289 2:99957837-99957859 CAGGCCAGGACTTCTAAAGCAGG + Intronic
935751161 2:106235101-106235123 AAAGAGAGGAATTTTACAGCTGG + Intergenic
935762073 2:106330399-106330421 AAAGAGAGGAATTTTAAAGCTGG + Intergenic
935807408 2:106762657-106762679 GAAACCAGGAGTTTGAAACCAGG - Intergenic
935824125 2:106926608-106926630 AAAGAGAGGAATTTTACAGCTGG + Intergenic
936614498 2:114034503-114034525 GAAGGGAGGTATTTTGAAGCTGG + Intergenic
936686717 2:114836374-114836396 AAAGAGAGAAATTTTAAAGCTGG + Intronic
937069824 2:119054571-119054593 AAAGAGAGGAATTTTACAGCTGG + Intergenic
937112038 2:119373845-119373867 AAAGAGAGGAATTTTACAGCTGG + Intergenic
937606319 2:123805896-123805918 AAAGAGAGGAATTTTACAGCTGG + Intergenic
937623369 2:124015809-124015831 GAAGCCAGGAGTTTGAGACCAGG - Intergenic
937798306 2:126051706-126051728 AAAGAGAGGAATTTTACAGCTGG + Intergenic
937838319 2:126496935-126496957 AAAGGGAGGAATTTTACAGCTGG + Intergenic
938102962 2:128511020-128511042 CATGCCAGGAATTTTAGGGCAGG + Intergenic
938128754 2:128693232-128693254 GGAGCCAGGAATGTTGGAGCGGG - Intergenic
938308681 2:130270795-130270817 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
938524875 2:132119747-132119769 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
938842564 2:135177229-135177251 AAAGAGAGGAATTTTACAGCTGG + Intronic
938858614 2:135342158-135342180 AAAGAGAGAAATTTTAAAGCTGG - Intronic
938872848 2:135499154-135499176 AAAGAGAGAAATTTTAAAGCTGG - Intronic
939012385 2:136861946-136861968 CAAGCCTGGAATGTTAATGCTGG + Intronic
939039409 2:137169959-137169981 GTAGTCAGGCATTTTAGAGCAGG + Intronic
939133217 2:138262679-138262701 AAAGAGAGGAATTTTACAGCTGG - Intergenic
939246059 2:139625163-139625185 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
939624042 2:144454779-144454801 GAACCCAGGATTTTCAAAGTTGG + Intronic
939748629 2:146011414-146011436 GAGGCCAGGAATTTGAGACCAGG + Intergenic
939796778 2:146655339-146655361 AAAGGGAGAAATTTTAAAGCTGG + Intergenic
940276191 2:151943182-151943204 AAAGAGAGGAATTTTACAGCTGG - Intronic
940487217 2:154311336-154311358 AAAGAGAGAAATTTTAAAGCTGG + Intronic
940948506 2:159645725-159645747 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
941381475 2:164798216-164798238 GAAGGCAGATATTTTAAAGAAGG - Intronic
941511510 2:166416450-166416472 AAAGATAGGAATTTTACAGCTGG - Intronic
942312924 2:174672076-174672098 AAAGAGAGAAATTTTAAAGCTGG - Intronic
942380864 2:175388606-175388628 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
942430385 2:175905084-175905106 GAAGCCAGGAGTTCGAAACCAGG - Intergenic
942453989 2:176125232-176125254 GAAGCCAGGCACTTTCAGGCTGG + Intergenic
942478252 2:176352785-176352807 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
942582235 2:177431134-177431156 AAAGAGAGGAATTTTACAGCTGG + Intronic
942802259 2:179889243-179889265 AAAGAGAGGAATTTTACAGCTGG - Intergenic
942997224 2:182277285-182277307 AAAGAGAGGAATTTTACAGCTGG - Intronic
943171578 2:184407558-184407580 AAAGAGAGGAATTTTACAGCTGG - Intergenic
943302137 2:186216539-186216561 TAAGACAGAAATTTTAAAGTTGG + Intergenic
943502723 2:188711995-188712017 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
943606574 2:189983858-189983880 AAAGAGAGAAATTTTAAAGCTGG + Intronic
943750842 2:191507856-191507878 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
943942965 2:194022676-194022698 AAAGAGAGGAATTTTACAGCTGG + Intergenic
944174705 2:196816911-196816933 CAAGAGAGGAATTTTACAGCTGG + Intergenic
944178665 2:196862633-196862655 AAAGAGAGAAATTTTAAAGCTGG - Intronic
944300425 2:198118300-198118322 GAACCCAGCAATTTTTAAGGTGG - Intronic
944395668 2:199263420-199263442 AAAGAGAGGAATTTTACAGCTGG - Intergenic
944397142 2:199281011-199281033 AAAGAGAGAAATTTTAAAGCTGG - Intronic
944753266 2:202733058-202733080 AAAGAGAGGAATTTTACAGCTGG + Intronic
944760766 2:202811208-202811230 AAAGAGAGAAATTTTAAAGCTGG - Intronic
944886619 2:204069610-204069632 GAAGTCAGGTATTTTTAATCAGG + Intergenic
945066616 2:205953038-205953060 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945456698 2:210058923-210058945 AAAGAGAGAAATTTTAAAGCTGG - Intronic
945488271 2:210424555-210424577 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945488548 2:210427111-210427133 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945516204 2:210765978-210766000 CAAGCCAGGAATTAAAAAGCCGG + Intergenic
945536500 2:211024905-211024927 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945897265 2:215497696-215497718 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
945919275 2:215738882-215738904 GGAGAGAGGAATTTTAAATCAGG + Intergenic
945932350 2:215867533-215867555 GAAGACATGAATTTTAAAGACGG - Intergenic
946170835 2:217894441-217894463 GAGGCCAGGAGTTTGAAACCAGG + Intronic
947114621 2:226755808-226755830 GAAGGCAGTAATTTTAAAAATGG - Intronic
947270385 2:228327770-228327792 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
947276438 2:228397195-228397217 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
947388781 2:229618918-229618940 GAAGCCAGGAGTTCTAGACCAGG + Intronic
947518569 2:230827870-230827892 GAAGCCAGGCATTTGGAAGAGGG - Intergenic
948012911 2:234664316-234664338 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1169162685 20:3395492-3395514 GAGGCCAGGAGTTCAAAAGCAGG - Intronic
1169280658 20:4264223-4264245 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1169351680 20:4873153-4873175 GAAGCCAAGAATTTTAAGGTTGG - Intronic
1169613704 20:7414119-7414141 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1169767747 20:9166511-9166533 GAAGCCAGGGACTATAACGCTGG - Intronic
1171046977 20:21818121-21818143 GAAGCAAGGAAATTTAGAGGGGG - Intergenic
1171409549 20:24936822-24936844 GGAGCCAGGACTTCTAAGGCTGG - Intergenic
1171492415 20:25530624-25530646 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1171777484 20:29382588-29382610 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1172264338 20:33597925-33597947 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1172470424 20:35189688-35189710 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1172660860 20:36567716-36567738 GAGGTCAGGAATTTGAAACCAGG + Intergenic
1173116423 20:40247722-40247744 GAAACCAGGAAATTCCAAGCTGG + Intergenic
1173823730 20:46034356-46034378 GTAGCCAGGAATTTCCAATCTGG - Intronic
1174260888 20:49294270-49294292 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1174430216 20:50462702-50462724 GAAGCTTGGAGTTTTAAAGCTGG + Intergenic
1174617719 20:51849085-51849107 GAGGCCAGGAGTTTGAGAGCAGG - Intergenic
1174909662 20:54593611-54593633 GAGCCCAGGAATTTGAGAGCAGG + Intronic
1176210195 20:63916337-63916359 AAAGAGAGGAATTTTACAGCTGG + Intronic
1176451501 21:6866129-6866151 AAAGACAGGAATTTTACAGCTGG - Intergenic
1176771653 21:13080101-13080123 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1176829669 21:13731180-13731202 AAAGACAGGAATTTTACAGCTGG - Intergenic
1176879996 21:14180437-14180459 AAAGAGAGGAATTTTACAGCTGG - Intronic
1176914684 21:14610643-14610665 CAAGAGAGAAATTTTAAAGCTGG - Intronic
1176985345 21:15430039-15430061 GAAGCCAGGAATTTTGAGACTGG - Intergenic
1177460513 21:21402729-21402751 AAAGAGAGGAATTTTACAGCTGG - Intronic
1177613630 21:23488314-23488336 GAAACCATGATTTTCAAAGCTGG + Intergenic
1177910605 21:27026288-27026310 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1177984789 21:27961018-27961040 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1178484451 21:33009246-33009268 GAATACTGGAATTTTAAAGTAGG + Intergenic
1178836282 21:36100294-36100316 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1179184569 21:39075090-39075112 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1179425252 21:41272987-41273009 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1179498566 21:41791105-41791127 GAGGCCAGGAGTTTGAAACCAGG - Intergenic
1179660989 21:42875027-42875049 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1179950362 21:44705980-44706002 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1180155592 21:45975725-45975747 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1180335116 22:11570833-11570855 GTAGCTAGGAATATTAATGCTGG - Intergenic
1180518782 22:16174548-16174570 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1181470822 22:23138346-23138368 GAGGCCAGGAATTTGAAACCAGG + Intronic
1181536282 22:23547790-23547812 AAAGAAAGGAATTTTACAGCTGG - Intergenic
1182485992 22:30639154-30639176 AAAGGGAGAAATTTTAAAGCTGG + Intronic
1182559024 22:31144550-31144572 GAGGCCAGGAGTTTGAAACCAGG + Intergenic
1182894412 22:33847117-33847139 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1183174034 22:36209413-36209435 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1183625367 22:38998163-38998185 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1184054353 22:42034316-42034338 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1184171497 22:42762408-42762430 GAACCCAGGAGTTTGAAACCAGG + Intergenic
1184807824 22:46807217-46807239 GAAGCCCTGAATTCTAAAGAAGG - Intronic
949099635 3:128515-128537 GAAGCCAGGAATTATAAATGAGG + Intergenic
949217569 3:1587971-1587993 AAAGAGAGGAATTTTACAGCTGG - Intergenic
949231277 3:1754014-1754036 AAAGAGAGGAATTTTACAGCTGG + Intergenic
949366976 3:3292308-3292330 AAAGAGAGGAATTTTACAGCTGG - Intergenic
949638949 3:6013826-6013848 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
949787935 3:7762118-7762140 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
949823420 3:8139428-8139450 CAAGCAAGGACTTTTAAAGGTGG + Intergenic
950064041 3:10096974-10096996 AAAGAGAGAAATTTTAAAGCTGG + Intronic
950198561 3:11026851-11026873 AAAGAGAGAAATTTTAAAGCTGG + Intronic
950231215 3:11277479-11277501 AAAGAGAGGAATTTTACAGCTGG + Intronic
950807524 3:15619805-15619827 AAAGAGAGGAATTTTACAGCTGG + Intronic
950818990 3:15738251-15738273 AAAGAGAGAAATTTTAAAGCTGG + Intronic
951212277 3:19988724-19988746 AAAGACAGAAATTTTAAAGCTGG - Intronic
951240752 3:20283449-20283471 AAAGAGAGGAATTTTACAGCTGG - Intergenic
951479938 3:23149517-23149539 GAACCCAGGAGTTTGAGAGCAGG - Intergenic
951859524 3:27236559-27236581 AAAGAGAGGAATTTTACAGCTGG + Intronic
951902275 3:27668489-27668511 GAACCCAGGAGTTTGAGAGCAGG + Intergenic
951941592 3:28085394-28085416 GAAGCCAGAAATTGTAAGGGAGG - Intergenic
951970460 3:28439375-28439397 GATGCCAGCAAGTATAAAGCAGG - Intronic
952288751 3:31994898-31994920 AAAGAGAGGAATTTTACAGCTGG + Intronic
952293731 3:32042636-32042658 AAAGAGAGGAATTTTACAGCTGG + Intronic
952725322 3:36578209-36578231 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
952934089 3:38382050-38382072 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953509289 3:43519077-43519099 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953519654 3:43629122-43629144 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953846611 3:46432447-46432469 AAAGAGAGGAATTTTACAGCTGG - Intergenic
953846633 3:46432580-46432602 AAAGAGAGGAATTTTACAGCTGG - Intergenic
953987885 3:47459506-47459528 AAAGAGAGGAATTTTACAGCTGG + Intronic
953994063 3:47506049-47506071 AAAGAGAGAAATTTTAAAGCTGG + Intronic
954843761 3:53535900-53535922 GAAGGCAGGAATTTTCACTCGGG - Intronic
955493104 3:59502779-59502801 GAAACCTGTAATTTTTAAGCAGG + Intergenic
955636040 3:61030733-61030755 AAAGACAGGAATTTTAAATATGG + Intronic
956037081 3:65105346-65105368 GAAGGCAGGACTTTTTGAGCAGG - Intergenic
956131285 3:66056131-66056153 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
956220621 3:66898760-66898782 AAAGAGAGGAATTTTACAGCTGG - Intergenic
956235085 3:67060656-67060678 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
956597064 3:70979051-70979073 GAGGCCAGGAGTTTGAAACCAGG + Intronic
957119460 3:76070748-76070770 AAAGAGAGAAATTTTAAAGCTGG - Intronic
957138132 3:76315921-76315943 AAAGAGAGGAATTTTACAGCTGG + Intronic
957373510 3:79326403-79326425 AAAGAGAGAAATTTTAAAGCTGG - Intronic
957432576 3:80130853-80130875 GAAGCCATGAATTTGGAAGAGGG - Intergenic
957469140 3:80636121-80636143 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
957778988 3:84793704-84793726 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
957874771 3:86131104-86131126 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
957926548 3:86821743-86821765 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
958194006 3:90219507-90219529 AAAGAGAGGAATTTTACAGCTGG - Intergenic
958271277 3:91502333-91502355 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958497234 3:94860833-94860855 GAAGAGAGGAATTTTACAGCTGG - Intergenic
958509143 3:95022785-95022807 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958603426 3:96328104-96328126 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958722025 3:97855673-97855695 AAAGAGAGAAATTTTAAAGCTGG + Intronic
958752926 3:98213723-98213745 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958756393 3:98254533-98254555 AAAGAGAGGAATTTTACAGCTGG + Intergenic
958761198 3:98310699-98310721 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
958998937 3:100939456-100939478 AAAGAGAGAAATTTTAAAGCTGG + Intronic
959005197 3:101012071-101012093 AAAGAGAGGAATTTTACAGCTGG + Intergenic
959126414 3:102294908-102294930 AAAGAGAGAAATTTTAAAGCTGG - Intronic
959220001 3:103506446-103506468 AAAGAGAGGAATTTTACAGCTGG + Intergenic
959261722 3:104090524-104090546 AAAGAGAGGAATTTTACAGCTGG - Intergenic
959696684 3:109255882-109255904 GAACCCAGGCATTTTGAAACTGG + Intergenic
959888035 3:111525047-111525069 AAAGAGAGGAATTTTATAGCTGG - Intronic
959888700 3:111530352-111530374 AAAGAGAGGAATTTTACAGCTGG - Intronic
959936797 3:112037718-112037740 AAAGAGAGAAATTTTAAAGCTGG - Intronic
959938928 3:112060024-112060046 AAAGAGAGAAATTTTAAAGCTGG + Intronic
960308406 3:116090669-116090691 AAAGAGAGAAATTTTAAAGCTGG + Intronic
960322510 3:116253703-116253725 GAACCCAGAAGTTTTAAAGCAGG + Intronic
960397648 3:117156733-117156755 GAACCCAGGAATAGTAGAGCTGG + Intergenic
960541326 3:118865512-118865534 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
960666807 3:120117231-120117253 AAAGAGAGGAATTTTACAGCTGG - Intergenic
960726750 3:120677819-120677841 AAAGAGAGAAATTTTAAAGCCGG - Intronic
961288674 3:125827597-125827619 AAAGAGAGGAATTTTACAGCTGG + Intergenic
961653950 3:128431337-128431359 GAAGCCAGGAGTTTGAAACCTGG - Intergenic
961892082 3:130138777-130138799 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
961898391 3:130188438-130188460 AAAGAGAGGAATTTTACAGCTGG - Intergenic
961923613 3:130452419-130452441 AAAGAGAGAAATTTTAAAGCTGG + Intronic
962290350 3:134131150-134131172 AAAGAGAGAAATTTTAAAGCTGG + Intronic
962651606 3:137499298-137499320 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
962758466 3:138486184-138486206 AAAGAGAGGAATTTTACAGCTGG + Intergenic
962764183 3:138546161-138546183 AAAGAGAGGAATTTTACAGCTGG - Intronic
962765276 3:138556646-138556668 AAAGAGAGAAATTTTAAAGCTGG + Intronic
962787394 3:138780896-138780918 GAGGCCAGGAATTTTAGATCAGG - Intronic
963176521 3:142303708-142303730 AAAGGGAGAAATTTTAAAGCTGG + Intergenic
963257754 3:143162674-143162696 GAAGACAGAAATTTAAAACCTGG + Intergenic
963414906 3:144983194-144983216 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
963441150 3:145342262-145342284 GAAGCCAGGAGCTTACAAGCTGG + Intergenic
963500117 3:146115095-146115117 AAAGAGAGAAATTTTAAAGCTGG - Intronic
963519599 3:146347408-146347430 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
963609576 3:147449316-147449338 GAAGCATGGAAATTGAAAGCAGG - Intronic
963641552 3:147866402-147866424 GAAGCCAGGAATTCAAGACCAGG - Intergenic
964754426 3:160080938-160080960 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
964756349 3:160093466-160093488 GAAGCCAGGACTTTTAATCTAGG - Intergenic
964840035 3:160983786-160983808 AAAGAGAGAAATTTTAAAGCTGG + Intronic
965540667 3:169868199-169868221 GAAGTCAGGGATGCTAAAGCAGG - Intronic
965928874 3:174017614-174017636 AAAGAGAGAAATTTTAAAGCTGG + Intronic
966124907 3:176564271-176564293 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
966142635 3:176772908-176772930 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
966151246 3:176869478-176869500 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
966511720 3:180771850-180771872 AAAGAGAGGAATTTTACAGCTGG + Intronic
966817388 3:183900376-183900398 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
967061230 3:185874499-185874521 GAAGCCAGGAATATTCAACATGG - Intergenic
967300825 3:188010453-188010475 AAAGAGAGGAATTTTACAGCTGG + Intergenic
967412725 3:189183155-189183177 AAAGAGAGAAATTTTAAAGCTGG + Intronic
967497903 3:190162525-190162547 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
967701941 3:192603557-192603579 AAAGAGAGGAATTTTACAGCTGG + Intronic
968041041 3:195589564-195589586 AAAGAGAGGAATTTTACAGCTGG + Intergenic
968192848 3:196683131-196683153 AAAGAGAGAAATTTTAAAGCCGG + Intronic
968212107 3:196857584-196857606 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
968367685 3:198199771-198199793 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
968421028 4:484983-485005 AAAGAGAGAAATTTTAAAGCTGG - Intronic
968612322 4:1562909-1562931 GAGGCCAGGATGTTGAAAGCAGG + Intergenic
968884108 4:3318129-3318151 GAAGCCAGGACTGTGCAAGCTGG - Intronic
969008578 4:4041902-4041924 AAAGAGAGGAATTTTACAGCTGG - Intergenic
969008618 4:4042211-4042233 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
969009282 4:4048190-4048212 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
969273266 4:6117294-6117316 AAAGAGAGAAATTTTAAAGCTGG + Intronic
969745070 4:9064159-9064181 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970056576 4:11980072-11980094 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970057934 4:11996433-11996455 AAAGAGAGGAATTTTACAGCTGG + Intergenic
970342463 4:15120965-15120987 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970393833 4:15645040-15645062 GCAGGCAGAAATTTTAAAGAGGG + Intronic
970448668 4:16145556-16145578 AAAGAGAGGAATTTTACAGCTGG - Intergenic
970742593 4:19255406-19255428 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
970956543 4:21818147-21818169 AAAGAGAGGAATTTTACAGCTGG - Intronic
971314017 4:25552242-25552264 GAAGCCAGGAATTAGAGACCAGG + Intergenic
971365874 4:25976777-25976799 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
971655361 4:29337260-29337282 GATGCCTGGAATTTGAAAGAGGG - Intergenic
971753798 4:30682606-30682628 AAAGAGAGGAATTTTACAGCTGG + Intergenic
971899903 4:32646243-32646265 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
971987503 4:33845638-33845660 AAAGATAGAAATTTTAAAGCTGG + Intergenic
972038175 4:34553812-34553834 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
972362339 4:38338751-38338773 AAAGAGAGGAATTTTACAGCTGG + Intergenic
972804625 4:42515910-42515932 GAAGCCAATAATTTTACAGAAGG - Intronic
972847489 4:43006879-43006901 AAAGAGAGAAATTTTAAAGCTGG - Intronic
973040259 4:45460684-45460706 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973043018 4:45497714-45497736 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
973198608 4:47474551-47474573 TAAGCCAGGAGTTTAAAAGAAGG + Intergenic
973585930 4:52391027-52391049 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973659057 4:53083694-53083716 AAAGAGAGGAATTTTACAGCTGG + Intronic
973799312 4:54460641-54460663 AAAGAGAGGAATTTTATAGCTGG - Intergenic
973799956 4:54467554-54467576 AAAGAGAGGAATTTTACAGCTGG - Intergenic
973881966 4:55281692-55281714 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973943749 4:55936472-55936494 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
974073665 4:57148771-57148793 GAAGCCAGGAGTTTGAGACCAGG - Intergenic
974185469 4:58440211-58440233 AAAGAGAGGAATTTTACAGCTGG + Intergenic
974193340 4:58536623-58536645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
974199493 4:58620532-58620554 GAAAGGAGAAATTTTAAAGCTGG - Intergenic
974230888 4:59112090-59112112 AAAGAGAGGAATTTTACAGCTGG - Intergenic
974449777 4:62038820-62038842 GAGGCCAGGAATTTGAGACCAGG - Intronic
974472615 4:62338048-62338070 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
974726965 4:65810543-65810565 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
974741461 4:66013373-66013395 AAAGAGAGGAATTTTATAGCTGG - Intergenic
974986610 4:69034799-69034821 AAAGAGAGAAATTTTAAAGCTGG - Intronic
974998394 4:69192229-69192251 AAAGAGAGGAATTTTACAGCTGG - Intronic
974998893 4:69196279-69196301 AAAGAGAGGAATTTTACAGCTGG + Intronic
974999221 4:69199124-69199146 AAAGAGAGGAATTTTACAGCTGG - Intronic
975014897 4:69403356-69403378 AAAGAGAGGAATTTTAAAGCAGG + Intronic
975228713 4:71905968-71905990 AAAGACAGGAATTTTACAGCTGG - Intergenic
975307640 4:72867338-72867360 AAAGAAAGGAATTTTACAGCTGG + Intergenic
975402429 4:73953238-73953260 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
975440251 4:74401608-74401630 GAGGCCAGGAATTTGAGACCAGG - Intergenic
975587551 4:75965583-75965605 AAAGAGAGAAATTTTAAAGCTGG - Intronic
975606004 4:76155076-76155098 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
975729073 4:77320055-77320077 AAAGAGAGGAATTTTACAGCTGG + Intronic
975790575 4:77945654-77945676 AAAGAGAGGAATTTTACAGCTGG + Intronic
975819202 4:78252692-78252714 AAAGAGAGGAATTTTACAGCTGG + Intronic
975827050 4:78331011-78331033 AAAGAGAGAAATTTTAAAGCTGG - Intronic
975954768 4:79824492-79824514 AAAGAGAGCAATTTTAAAGCTGG + Intergenic
976023690 4:80662299-80662321 AAAGAGAGAAATTTTAAAGCTGG - Intronic
976375357 4:84339646-84339668 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
976437484 4:85034500-85034522 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
976453297 4:85217130-85217152 AAAGAGAGGAATTTTACAGCTGG - Intergenic
976636713 4:87293660-87293682 AAAGAGAGGAATTTTACAGCTGG + Intergenic
976649380 4:87418747-87418769 AAAGAGAGGAATTTTACAGCTGG - Intergenic
976741768 4:88364069-88364091 AAAGAGAGGAATTTTACAGCTGG + Intergenic
976803145 4:89015435-89015457 AAAGAGAGAAATTTTAAAGCTGG - Intronic
976816359 4:89151726-89151748 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
976971178 4:91104422-91104444 AAAGAGAGGAATTTTACAGCTGG - Intronic
977140615 4:93366736-93366758 AAAGAGAGAAATTTTAAAGCCGG - Intronic
977354389 4:95926844-95926866 AAAGAGAGGAATTTTACAGCTGG - Intergenic
977388739 4:96381318-96381340 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
977473559 4:97473785-97473807 AAAGAGAGAAATTTTAAAGCTGG - Intronic
977605748 4:98983820-98983842 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
978023844 4:103848135-103848157 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
978024030 4:103849545-103849567 AAAGAGAGGAATTTTACAGCTGG - Intergenic
978193736 4:105946531-105946553 GAAGAGAGGAATTTTACAGCTGG + Intronic
978212030 4:106148382-106148404 AAAGAGAGAAATTTTAAAGCTGG - Intronic
978467329 4:109022197-109022219 AAAGAGAGGAATTTTACAGCTGG - Intronic
978505569 4:109453004-109453026 AAAGAGAGAAATTTTAAAGCTGG + Intronic
978734823 4:112073729-112073751 AAAGAGAGGAATTTTACAGCTGG - Intergenic
979016502 4:115441347-115441369 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
979027266 4:115593144-115593166 AAAGACAGGAATTTTACAGCTGG - Intergenic
979137169 4:117124396-117124418 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979195955 4:117920122-117920144 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979256100 4:118609482-118609504 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
979318144 4:119291176-119291198 GAACTCAGGAATTTGGAAGCAGG + Exonic
979332244 4:119431055-119431077 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979400559 4:120244785-120244807 AAAGAGAGGAATTTTATAGCTGG + Intergenic
979503556 4:121467708-121467730 AAAGAGAGGAATTTTACAGCTGG + Intergenic
979765642 4:124462188-124462210 AAAGAGAGGAATTTTACAGCTGG - Intergenic
979793144 4:124811934-124811956 AAAGAGAGGAATTTTACAGCTGG + Intergenic
979951091 4:126894873-126894895 GAACCCAGGTATTTCACAGCTGG - Intergenic
979970050 4:127123669-127123691 AAAGACAGAAATTTTAAAGCTGG + Intergenic
980158191 4:129131878-129131900 AAAACGAGGAATTTTACAGCTGG - Intergenic
980180890 4:129399359-129399381 AAAGAGAGGAATTTTACAGCTGG + Intergenic
980232031 4:130057528-130057550 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
980245952 4:130243273-130243295 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980269715 4:130568365-130568387 GAAGCCAAGTATAATAAAGCAGG - Intergenic
980278252 4:130683909-130683931 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980278944 4:130693026-130693048 GAAGCCAGGATGTTTAAAGAGGG - Intergenic
980298557 4:130957386-130957408 AAAGAGAGGAATTTTACAGCTGG + Intergenic
980313136 4:131161913-131161935 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980549094 4:134309867-134309889 TAAGGCAGGAATTGTTAAGCAGG + Intergenic
980588456 4:134851003-134851025 GAAGTCAGGAATCTACAAGCGGG + Intergenic
980600465 4:135018453-135018475 AAAGAGAGGAATTTTACAGCTGG + Intergenic
980646763 4:135652616-135652638 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980978393 4:139633104-139633126 AAAGAGAGGAATTTTACAGCTGG - Intergenic
981421089 4:144551181-144551203 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
981424496 4:144587683-144587705 AAAGAGAGGAATTTTACAGCTGG + Intergenic
981448409 4:144867259-144867281 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
981739700 4:147989075-147989097 AAAGAGAGAAATTTTAAAGCTGG + Intronic
981754226 4:148123606-148123628 AAAGAGAGGAATTTTACAGCTGG - Intronic
982175331 4:152700789-152700811 AAAGAGAGAAATTTTAAAGCTGG + Intronic
982513612 4:156317011-156317033 AAAGAGAGGAATTTTACAGCTGG + Intergenic
982587308 4:157258756-157258778 AAAGGGAGAAATTTTAAAGCTGG - Intronic
982807920 4:159789454-159789476 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
982830654 4:160055542-160055564 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
982887310 4:160797955-160797977 AAAGAGAGGAATTTTACAGCTGG + Intergenic
982903777 4:161042570-161042592 AAAGGGAGAAATTTTAAAGCTGG + Intergenic
982922379 4:161291786-161291808 AAAGAGAGGAATTTTATAGCTGG - Intergenic
983032294 4:162817917-162817939 AAAGTGAGGAATTTTACAGCTGG - Intergenic
983303370 4:165955913-165955935 CAAGAGAGGAATTTTACAGCTGG + Intronic
983304316 4:165966607-165966629 AAAGAGAGAAATTTTAAAGCTGG + Intronic
983419165 4:167495962-167495984 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
983759474 4:171387277-171387299 AAAGAGAGGAATTTTACAGCTGG + Intergenic
983884904 4:172969949-172969971 AAAGAGAGGAATTTTACAGCTGG + Intronic
983894123 4:173063520-173063542 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984064209 4:175028189-175028211 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984157832 4:176212765-176212787 AAAGAGAGGAATTTTACAGCTGG - Intergenic
984324580 4:178235940-178235962 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984905911 4:184625694-184625716 CAAGAGAGAAATTTTAAAGCTGG + Intergenic
985026847 4:185746923-185746945 GAAGACAGGGACTTTAAAGAGGG + Intronic
985332326 4:188851752-188851774 AAAGAGAGGAATTTTACAGCTGG - Intergenic
985362346 4:189189138-189189160 AAAGAGAGGAATTTTACAGCTGG + Intergenic
985469285 5:28260-28282 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
986377385 5:7146237-7146259 AAAGAGAGGAATTTTACAGCTGG + Intergenic
986781930 5:11074580-11074602 GAATCTAGGAATTCTAAACCTGG - Intronic
986950106 5:13072712-13072734 AAAGAGAGGAATTTTACAGCTGG + Intergenic
987423091 5:17743991-17744013 GAAGACAGGAATTTTTAAAGTGG + Intergenic
987583225 5:19822515-19822537 AAAGAGAGAAATTTTAAAGCTGG + Intronic
987743476 5:21940005-21940027 GAAGTCAGGAGTTTTAGACCAGG + Intronic
987902599 5:24031843-24031865 AAAGAGAGGAATTTTACAGCTGG - Intronic
987978218 5:25043966-25043988 AAAGAGAGGAATTTTACAGCTGG + Intergenic
988047019 5:25969526-25969548 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988222583 5:28368420-28368442 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
988240335 5:28599903-28599925 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988245461 5:28675057-28675079 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
988330016 5:29824600-29824622 AAAGCCAAGAATTTTACATCTGG - Intergenic
988343478 5:30006158-30006180 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988396622 5:30704289-30704311 AAAGAGAGGAATTTTACAGCTGG + Intergenic
988529541 5:32015463-32015485 GAGGCCAGGAGTTTGAAACCAGG - Intronic
988810339 5:34778686-34778708 GAGGCCAGGAATTTGAGACCAGG + Intronic
988874082 5:35424680-35424702 GAAGCCTGGATTTTCAAGGCGGG + Intergenic
989383553 5:40833050-40833072 GAAGCCAGGCTTTTAAAAGTAGG - Intronic
989387150 5:40865326-40865348 AAAGAGAGGAATTTTACAGCTGG - Intergenic
989420319 5:41230797-41230819 AAAGAGAGGAATTTTACAGCTGG - Intronic
989455111 5:41634968-41634990 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989487888 5:42013089-42013111 GAGGCCAGGAGTTTTAGACCAGG + Intergenic
989580249 5:43025762-43025784 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989771582 5:45152466-45152488 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989828615 5:45889271-45889293 AAAGATAGAAATTTTAAAGCTGG + Intergenic
990123784 5:52488610-52488632 AAAGAGAGAAATTTTAAAGCGGG - Intergenic
990234470 5:53752074-53752096 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
990300527 5:54445220-54445242 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
990302325 5:54461260-54461282 AAAGACAGAAATTTTAAAGCTGG + Intergenic
990339578 5:54809085-54809107 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
990395545 5:55374928-55374950 AAAGAGAGAAATTTTAAAGCCGG + Intronic
990695089 5:58407528-58407550 GATGTCAGGAATTTCAGAGCTGG + Intergenic
990704598 5:58514258-58514280 AAAGAGAGGAATTTTACAGCTGG - Intergenic
990964651 5:61432023-61432045 GAAGACATGAATTTTAAAAATGG - Intronic
991101326 5:62796858-62796880 AAAGAGAGGAATTTTATAGCTGG + Intergenic
991250828 5:64559224-64559246 AAAGAGAGAAATTTTAAAGCTGG - Intronic
991251926 5:64572219-64572241 GAAAACAGCAATTTAAAAGCTGG - Intronic
991264156 5:64697058-64697080 AAAGAGAGGAATTTTACAGCTGG - Intronic
991542567 5:67746024-67746046 AAAGAGAGGAATTTTACAGCTGG + Intergenic
991626075 5:68602224-68602246 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
991712608 5:69422816-69422838 AAAGAGAGAAATTTTAAAGCTGG - Intronic
991991566 5:72344716-72344738 AAAGAGAGAAATTTTAAAGCTGG + Intronic
992160235 5:73993851-73993873 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
992895628 5:81242730-81242752 TAAGCAAGGGTTTTTAAAGCAGG + Intronic
993750374 5:91658358-91658380 AAAGAGAGGAATTTTACAGCTGG - Intergenic
994386876 5:99143244-99143266 AAAGAGAGGAATTTTACAGCTGG + Intergenic
994479911 5:100321419-100321441 GAAGCATGCAATTTTAGAGCTGG - Intergenic
994521220 5:100839039-100839061 GAGGCCAGGAGTTTGAAATCAGG - Intronic
994615396 5:102098612-102098634 AAAGAGAGGAATTTTACAGCTGG + Intergenic
994625822 5:102217179-102217201 TCAGCCAGGTATTGTAAAGCTGG + Intergenic
994734389 5:103534119-103534141 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
994744645 5:103663657-103663679 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
994875765 5:105419117-105419139 AAAGAGAGGAATTTTACAGCTGG + Intergenic
994876995 5:105436692-105436714 AAAGAGAGGAATTTTATAGCTGG + Intergenic
995019021 5:107346374-107346396 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
995120056 5:108526470-108526492 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
995187366 5:109286407-109286429 AAAGAGAGGAATTTTACAGCTGG + Intergenic
995252146 5:110006028-110006050 AAAGAGAGGAATTTTACAGCTGG - Intergenic
995370902 5:111418152-111418174 AAAGAGAGAAATTTTAAAGCTGG + Intronic
995593910 5:113728816-113728838 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
995851279 5:116548454-116548476 GGAGTCAGGAATTATAAAACAGG + Intronic
996097510 5:119414428-119414450 AAAGAGAGGAATTTTATAGCTGG - Intergenic
996101602 5:119450574-119450596 AAAGGGAGGAATTTTACAGCTGG + Intergenic
996104224 5:119480373-119480395 AAAGAGAGAAATTTTAAAGCTGG + Intronic
996517173 5:124383458-124383480 AAAGGGAGGAATTTTACAGCTGG - Intergenic
996753361 5:126911379-126911401 AAAGAGAGAAATTTTAAAGCTGG - Intronic
996893220 5:128447801-128447823 AAAGAGAGAAATTTTAAAGCTGG - Intronic
997089808 5:130843508-130843530 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
997115765 5:131124226-131124248 AAAGAGAGGAATTTTACAGCTGG - Intergenic
997249741 5:132379382-132379404 GAGGCCAGGAATTAAAAACCAGG - Intronic
997481824 5:134191278-134191300 GAAGCCAGGATTTTTAAAGTAGG - Intronic
997737048 5:136220867-136220889 AAAGAGAGGAATTTTACAGCTGG - Intronic
997765432 5:136498878-136498900 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
997920825 5:137977510-137977532 AAAGAGAGAAATTTTAAAGCTGG - Intronic
998585126 5:143419515-143419537 AAAGAGAGAAATTTTAAAGCTGG + Intronic
998642004 5:144021782-144021804 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
998777177 5:145616506-145616528 AAAGAGAGAAATTTTAAAGCTGG + Intronic
999093179 5:148955416-148955438 AAAGAGAGAAATTTTAAAGCTGG + Intronic
999308736 5:150537838-150537860 GAAGAGAGAAATTTTAAAGCTGG - Intronic
999412790 5:151366829-151366851 AAAGAGAGGAATTTTACAGCTGG + Intergenic
999663892 5:153893350-153893372 GAAGCCAGGATTTGGAAAGTGGG + Intergenic
999990491 5:157045722-157045744 GAAGCAAGGAATATTAGATCTGG - Intronic
1000004496 5:157170506-157170528 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1000401022 5:160827188-160827210 AAAGAGAGGAATTTTACAGCTGG - Intronic
1000471729 5:161651717-161651739 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1000562703 5:162810367-162810389 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1000615315 5:163419478-163419500 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1000880582 5:166692652-166692674 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1000954476 5:167526238-167526260 GAAGCAAGGATATTTAAAACTGG + Intronic
1001189814 5:169619218-169619240 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1001521565 5:172397557-172397579 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1001522148 5:172402562-172402584 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1002479604 5:179491443-179491465 GAGCCCAGGAGTTTGAAAGCAGG + Intergenic
1002651637 5:180700895-180700917 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1002726905 5:181305000-181305022 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1003068872 6:2928452-2928474 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1003079389 6:3008742-3008764 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1003801981 6:9680583-9680605 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1003923350 6:10854369-10854391 AAAGAGAGGAATTTTACAGCTGG - Intronic
1004060845 6:12196613-12196635 GAAGGAAGGATTTTTGAAGCAGG - Intergenic
1004164491 6:13244101-13244123 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1004230496 6:13828898-13828920 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1004297804 6:14429879-14429901 AATGTCAGGAATTTTAAAACGGG + Intergenic
1004471258 6:15931495-15931517 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1004672173 6:17807808-17807830 AAAGAGAGGAATTTTACAGCTGG - Intronic
1004778297 6:18873641-18873663 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1005132425 6:22524448-22524470 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1005693266 6:28327944-28327966 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1005761407 6:28971255-28971277 GAAACCATGATTTTTAAAGCAGG + Intergenic
1005971393 6:30764632-30764654 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006218321 6:32465570-32465592 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006238342 6:32655836-32655858 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006292665 6:33151935-33151957 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1006418011 6:33916367-33916389 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006661821 6:35652899-35652921 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1007038472 6:38700111-38700133 AAAGAGAGGAATTTTACAGCTGG - Intronic
1007080673 6:39100891-39100913 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1007899431 6:45396617-45396639 GAGCCCAGGAATTTGAGAGCAGG - Intronic
1008100533 6:47385670-47385692 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1008167242 6:48153214-48153236 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1008251198 6:49242214-49242236 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1008515227 6:52312608-52312630 GAAGGCAGGAAATTGAGAGCTGG - Intergenic
1008585523 6:52944865-52944887 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1008909651 6:56719728-56719750 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1008983862 6:57518977-57518999 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1009039119 6:58156296-58156318 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1009171919 6:60411884-60411906 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1009215012 6:60911137-60911159 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1009447297 6:63757657-63757679 AAAGAGAGGAATTTTACAGCTGG - Intronic
1009544207 6:65003659-65003681 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1009720133 6:67458082-67458104 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1009789707 6:68385896-68385918 AAAGAGAGGAATTTTATAGCTGG - Intergenic
1009826266 6:68868977-68868999 AAAGCACAGAATTTTAAAGCTGG - Intronic
1010102934 6:72131417-72131439 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1010236167 6:73576539-73576561 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1010305015 6:74309922-74309944 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1010465098 6:76158357-76158379 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1010489738 6:76461210-76461232 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1010776360 6:79890831-79890853 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1010796474 6:80122511-80122533 AAAGTGAGGAATTTTACAGCTGG + Intronic
1010810643 6:80295086-80295108 AAAGAGAGGAATTTTACAGCTGG - Intronic
1011066137 6:83327869-83327891 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1011314781 6:86019133-86019155 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1011586575 6:88932560-88932582 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1011590819 6:88969185-88969207 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1011608601 6:89128742-89128764 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1011681066 6:89783742-89783764 AAAGAGAGGAATTTTACAGCTGG - Intronic
1011842536 6:91519569-91519591 GGAGCCAAGAATTTTAATGATGG + Intergenic
1012143465 6:95651791-95651813 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1012216453 6:96591817-96591839 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1012607070 6:101170743-101170765 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1012704394 6:102503110-102503132 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1012746243 6:103092966-103092988 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1013346873 6:109269086-109269108 GAAGAGATAAATTTTAAAGCTGG - Intergenic
1013500323 6:110743034-110743056 AAAGAGAGGAATTTTACAGCTGG - Intronic
1013664065 6:112328647-112328669 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1013865179 6:114688395-114688417 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1013920906 6:115402466-115402488 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1013927701 6:115493201-115493223 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1014119853 6:117712339-117712361 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1014251457 6:119119422-119119444 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1014290713 6:119554499-119554521 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1014319370 6:119907530-119907552 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1014469560 6:121798168-121798190 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1015180787 6:130360383-130360405 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1015378219 6:132534859-132534881 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1015545384 6:134356306-134356328 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1015820457 6:137254972-137254994 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1016173402 6:141048280-141048302 GAAGACATAAATTTAAAAGCTGG + Intergenic
1016192933 6:141293537-141293559 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1016534783 6:145097910-145097932 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1016586755 6:145697181-145697203 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1016865747 6:148764586-148764608 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1016909286 6:149181364-149181386 CAATCCAGGTATTCTAAAGCAGG + Intergenic
1017107555 6:150902226-150902248 AAAGTCATGAATTTTTAAGCTGG - Intronic
1017849964 6:158296704-158296726 AAAGAGAGGAATTTTACAGCTGG + Intronic
1017850732 6:158303307-158303329 AAAGAGAGGAATTTTACAGCTGG + Intronic
1017854579 6:158339148-158339170 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1017855282 6:158345476-158345498 AAAGAGAGGAATTTTACAGCTGG + Intronic
1018059794 6:160081262-160081284 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1018102105 6:160449774-160449796 AAAGAGAGGAATTTTACAGCTGG + Intronic
1018139957 6:160821290-160821312 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1018985224 6:168631188-168631210 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1019059278 6:169243432-169243454 GAAGTCAGGCATTTCAAAGATGG - Intronic
1019072033 6:169354740-169354762 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1020048426 7:5062312-5062334 GAAGAGAGAAATTTTAAAGCTGG + Intronic
1020329046 7:6999695-6999717 AAAGAAAGGAATTTTACAGCTGG - Intergenic
1020329086 7:7000008-7000030 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020603634 7:10307461-10307483 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1020615697 7:10458176-10458198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020738432 7:11983192-11983214 AAAGACAGAAATTTTAAAGCTGG + Intergenic
1020834916 7:13136877-13136899 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1020909287 7:14108619-14108641 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020981418 7:15074060-15074082 GATGGTAGGAATTTTAAAACTGG + Intergenic
1021176743 7:17458618-17458640 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1021472994 7:21028118-21028140 GATGCCAGGGCTTTTTAAGCCGG + Intergenic
1021924379 7:25520668-25520690 GAAGCTGGGAGTTGTAAAGCAGG - Intergenic
1023502830 7:40868759-40868781 GAGGCCAGGAATTTTGAGACTGG - Intergenic
1023565879 7:41523272-41523294 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1023659844 7:42460302-42460324 GAAGCCAGGAATTTTCACTTGGG - Intergenic
1023668905 7:42555503-42555525 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024010635 7:45263293-45263315 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024071805 7:45792613-45792635 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024122850 7:46262212-46262234 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024146815 7:46525168-46525190 GAACCCAGGGAATTGAAAGCAGG + Intergenic
1024213129 7:47224002-47224024 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024402977 7:48946382-48946404 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024408777 7:49014707-49014729 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024497380 7:50064112-50064134 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1024586473 7:50846087-50846109 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024756630 7:52541176-52541198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024942418 7:54776448-54776470 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024946186 7:54809463-54809485 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024966138 7:55023432-55023454 GAAGCCAGGAGTTTGAGACCAGG + Intronic
1024984283 7:55182083-55182105 CAAGCCAGGTATTTCACAGCTGG + Intronic
1025108876 7:56196093-56196115 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1025116800 7:56265109-56265131 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1025244596 7:57307084-57307106 GAAGCTTGGAGTTTTAAAGCTGG - Intergenic
1025749443 7:64280677-64280699 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1025760121 7:64381807-64381829 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1027525359 7:79262107-79262129 ACAGACAGGTATTTTAAAGCAGG - Intronic
1027566650 7:79802601-79802623 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1027793188 7:82658555-82658577 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1028191537 7:87858473-87858495 AAAGAGAGGAATTTTACAGCTGG - Intronic
1028356807 7:89919945-89919967 GAAACCTGGAATTATGAAGCTGG + Intergenic
1028435081 7:90794042-90794064 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1028539332 7:91925085-91925107 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1028602178 7:92614220-92614242 GAAGAAAGGAATTTCAAACCAGG + Exonic
1028786993 7:94806985-94807007 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1028999847 7:97141455-97141477 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1029664459 7:101986063-101986085 GAAGCCTGGAGTTGTTAAGCTGG + Intronic
1030056081 7:105584692-105584714 GGAGAGAGAAATTTTAAAGCTGG - Intronic
1030070927 7:105696887-105696909 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1030279388 7:107755803-107755825 GAACCCAGGAATTCTAATTCTGG - Intronic
1030444504 7:109632607-109632629 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1030497786 7:110320982-110321004 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1030519573 7:110581392-110581414 GAGGCCAGGAGTTTGAAACCAGG + Intergenic
1030601470 7:111597607-111597629 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1030663712 7:112250565-112250587 AAAGAGAGAAATTTTAAAGCCGG - Intronic
1031229282 7:119084721-119084743 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1031508810 7:122623206-122623228 AAACCCAGGTATTTTATAGCTGG - Intronic
1031513950 7:122679711-122679733 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1031560124 7:123228208-123228230 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1031636193 7:124103838-124103860 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1031838289 7:126705066-126705088 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1031876065 7:127142189-127142211 GAAGCCAGGAGTTTGAGACCAGG - Intronic
1031930421 7:127680042-127680064 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1031997009 7:128239625-128239647 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1032003245 7:128280209-128280231 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1032166158 7:129546708-129546730 GAAGTCAGGAATTTGAGAACAGG + Intergenic
1032937055 7:136745240-136745262 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1033166565 7:139043390-139043412 GAACCCTGGAATGATAAAGCTGG + Intergenic
1033677039 7:143553018-143553040 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1033694796 7:143776419-143776441 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1033716717 7:144010066-144010088 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1033721272 7:144061647-144061669 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1034102584 7:148463133-148463155 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1034251814 7:149698278-149698300 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1034363417 7:150522811-150522833 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1034367076 7:150560380-150560402 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1034583800 7:152070860-152070882 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1034929687 7:155151901-155151923 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1035135232 7:156697067-156697089 AAAGAGAGGAATTTTATAGCTGG + Intronic
1035572795 8:684727-684749 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1035592581 8:827899-827921 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1035640209 8:1179011-1179033 GAAGCTGGGAGTTTTACAGCAGG - Intergenic
1035686838 8:1529805-1529827 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1035926819 8:3736710-3736732 GAAGCCAGGCAGTGTGAAGCAGG - Intronic
1036158398 8:6363731-6363753 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1036373755 8:8182700-8182722 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1036495909 8:9269782-9269804 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1036514509 8:9431269-9431291 AAAGACAGAAGTTTTAAAGCTGG - Intergenic
1036756714 8:11476121-11476143 GAAGCCAGGAATGTTCCAGATGG + Intergenic
1036877148 8:12482941-12482963 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1036950672 8:13136126-13136148 GAAAGCAGGACTTTTAGAGCAGG + Intronic
1036997499 8:13676071-13676093 AAAGAGAGGAATTTTACAGCCGG + Intergenic
1036999240 8:13698157-13698179 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1037017487 8:13926386-13926408 GAAGCCAGTAATTTCAATGAGGG - Intergenic
1037063441 8:14545063-14545085 AAAGAGAGGAATTTTACAGCTGG - Intronic
1037136896 8:15473587-15473609 AAAGAGAGGAATTTTACAGCTGG + Intronic
1037312728 8:17573795-17573817 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1037327180 8:17704029-17704051 AAAGAGAGGAATTTTACAGCTGG - Intronic
1038125180 8:24665384-24665406 AAAGCCTGGAATTGAAAAGCTGG - Intergenic
1038153325 8:24962120-24962142 GAAGCCAGGATATGTAACGCCGG + Intergenic
1038197152 8:25378881-25378903 AAAGAGAGGAATTTTACAGCTGG + Intronic
1038786515 8:30622269-30622291 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1038991940 8:32877717-32877739 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1039183069 8:34888094-34888116 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1039501633 8:38022258-38022280 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1039580441 8:38661783-38661805 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1039598490 8:38812403-38812425 AAAGAGAGGAATTTTACAGCTGG - Intronic
1039691183 8:39866430-39866452 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1039822100 8:41143436-41143458 GAAGCCAGGAAATTGAGACCAGG + Intergenic
1040139441 8:43893512-43893534 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1040538804 8:48333041-48333063 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1040634370 8:49254955-49254977 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1040679023 8:49786863-49786885 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1040842713 8:51801558-51801580 AAAGAGAGGAATTTTACAGCTGG - Intronic
1041015021 8:53584563-53584585 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1041033910 8:53767082-53767104 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1041164162 8:55074412-55074434 AAAGACAGCAATTTTAAAGCTGG - Intergenic
1041559645 8:59201587-59201609 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041584106 8:59495969-59495991 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041649698 8:60289801-60289823 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041746640 8:61214389-61214411 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1041907786 8:63052603-63052625 AAAGAAAGGAATTTTACAGCTGG - Intronic
1041974361 8:63780183-63780205 GGAGGCAGGAATTTTCAAACAGG + Intergenic
1042191349 8:66190766-66190788 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1042191896 8:66195469-66195491 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1042197762 8:66247790-66247812 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1042198013 8:66250014-66250036 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1042355564 8:67823986-67824008 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1042428809 8:68680420-68680442 AAAGAGAGGAATTTTACAGCTGG + Intronic
1042529283 8:69798034-69798056 CAAACGAGAAATTTTAAAGCTGG - Intronic
1042709200 8:71696681-71696703 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1042934155 8:74042026-74042048 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1043327516 8:79070648-79070670 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1043861569 8:85323562-85323584 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1044003412 8:86913494-86913516 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1044064831 8:87686345-87686367 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1044086231 8:87945413-87945435 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1044142237 8:88670547-88670569 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1044170405 8:89043962-89043984 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1044182359 8:89211537-89211559 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1044307748 8:90657303-90657325 AAAGGGAGGAATTTTACAGCTGG + Intronic
1044318585 8:90777090-90777112 AAAGAGAGGAATTTTACAGCTGG + Intronic
1044590300 8:93907912-93907934 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1045954311 8:107889201-107889223 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1046076617 8:109319883-109319905 AAAGAGAGAAATTTTAAAGCCGG + Intronic
1046153314 8:110256529-110256551 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1046187904 8:110746853-110746875 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1046282531 8:112052875-112052897 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1046342717 8:112879651-112879673 AAAGCGAGAAATTTTAAAGCTGG - Intronic
1046494614 8:114997320-114997342 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1046749830 8:117915095-117915117 AAAGAGAGGAATTTTACAGCTGG - Intronic
1047741334 8:127809405-127809427 AAAGCCAGGAGTTTTAAGCCTGG - Intergenic
1047880897 8:129192237-129192259 TGAGCCAGGAATTTTACAGATGG + Intergenic
1047922218 8:129647015-129647037 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1048002964 8:130394704-130394726 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1048033744 8:130657340-130657362 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1048081637 8:131134668-131134690 AAAGAGAGGAATTTTATAGCTGG + Intergenic
1048185597 8:132237662-132237684 GAGGCCAGGAAGCTTAAGGCTGG + Intronic
1048239147 8:132723917-132723939 AAAGAGAGGAATTTTACAGCTGG + Intronic
1048479099 8:134771222-134771244 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1048573103 8:135671024-135671046 AAAGCCAGGTAATTCAAAGCAGG - Intergenic
1048714695 8:137255093-137255115 GAATCAAAGAATTTCAAAGCTGG + Intergenic
1048809636 8:138274258-138274280 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1048820298 8:138374154-138374176 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1048825670 8:138423428-138423450 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1049500795 8:142964172-142964194 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1049839296 8:144760718-144760740 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1050394538 9:5181022-5181044 AAAGAAAGGAATTTTACAGCTGG - Intronic
1050543008 9:6686222-6686244 GAAGCCAGGAATTCAAGACCAGG - Intergenic
1051417824 9:16861126-16861148 GAGGCCAGGAGTTTGAAACCAGG + Intronic
1051549860 9:18316001-18316023 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1051658334 9:19403827-19403849 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1051742632 9:20266293-20266315 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1051810134 9:21039340-21039362 GAAGCAAGGAATTTTCACTCAGG + Intergenic
1051833844 9:21311801-21311823 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1052083759 9:24238950-24238972 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1052354933 9:27494449-27494471 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1052426415 9:28311082-28311104 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1052456109 9:28700168-28700190 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1053651553 9:40175072-40175094 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1053703621 9:40727352-40727374 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054413681 9:64850816-64850838 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054533029 9:66201130-66201152 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054978059 9:71171441-71171463 AAAGAGAGAAATTTTAAAGCCGG - Intronic
1055340139 9:75272839-75272861 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055348618 9:75362181-75362203 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1055451520 9:76435282-76435304 AAAGAGAGGAATTTTACAGCTGG - Intronic
1055486976 9:76765848-76765870 TCAGTCAAGAATTTTAAAGCTGG - Intronic
1055622667 9:78142683-78142705 AAAGACAGGAATTTTACAGCTGG - Intergenic
1055784908 9:79862205-79862227 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1055830401 9:80371793-80371815 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055907997 9:81316053-81316075 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055931356 9:81562823-81562845 AAAGCCAGGAAATTTGAACCAGG - Intergenic
1056082897 9:83115053-83115075 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1056470290 9:86899230-86899252 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1056894896 9:90536065-90536087 GAAGAGAGAAATTTTAAAGCTGG + Intergenic
1057013370 9:91628356-91628378 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057099203 9:92341470-92341492 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057100542 9:92354824-92354846 AAAGAGAGGAATTTTACAGCTGG + Intronic
1057145364 9:92755539-92755561 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057391340 9:94643616-94643638 GAGCCCAGGAATTTTAAAAGCGG + Intergenic
1057538761 9:95944732-95944754 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1057715651 9:97493305-97493327 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1057784823 9:98078973-98078995 AAAGCCAGGAAGTTTCAAGAAGG - Intronic
1057862155 9:98649337-98649359 GCATCCTGGAATTTCAAAGCTGG + Intronic
1058225504 9:102356537-102356559 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1058252253 9:102713489-102713511 AAAGACAGGAATTTTACAGCTGG - Intergenic
1058253211 9:102728773-102728795 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1058265245 9:102890641-102890663 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1058268483 9:102937591-102937613 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1058288751 9:103211320-103211342 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1058542925 9:106030710-106030732 AAAGAGAGGAATTTTATAGCTGG - Intergenic
1058802308 9:108556616-108556638 TGAGCCAGGAATTCTAAACCAGG + Intergenic
1058922675 9:109632178-109632200 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1058953783 9:109927122-109927144 GATGGCAGGAATTATAATGCAGG - Intronic
1059022344 9:110590225-110590247 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1059112278 9:111568717-111568739 AAAGAGAGGAATTTTACAGCTGG - Intronic
1059198346 9:112392039-112392061 AAAGAGAGGAATTTTACAGCTGG + Intronic
1059199268 9:112399176-112399198 AAAGAGAGGAATTTTACAGCTGG + Intronic
1059252032 9:112894465-112894487 GAAGCCAGGAGTTTGAGACCAGG + Intergenic
1059281889 9:113141507-113141529 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1059523130 9:114962646-114962668 AAAGAGAGGAATTTTATAGCTGG + Intergenic
1059580835 9:115546716-115546738 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1059701765 9:116781835-116781857 GAAGAAAGGAATCTGAAAGCTGG + Intronic
1060173197 9:121478455-121478477 GGAGGCAGGCATTTTAAATCTGG - Intergenic
1060948529 9:127585827-127585849 GAGGCCAGGAATTTGAAACCAGG - Intergenic
1061104614 9:128519861-128519883 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1061343057 9:129998787-129998809 GAGGCCAGTAATTTTTAAGGTGG - Intronic
1061530963 9:131212489-131212511 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1062752026 9:138262476-138262498 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1203517680 Un_GL000213v1:18388-18410 AAAGACAGGAATTTTACAGCTGG + Intergenic
1185892999 X:3836592-3836614 GAAGCCAGGAAAGGTAAGGCTGG + Intronic
1185898108 X:3875012-3875034 GAAGCCAGGAAAGGTAAGGCTGG + Intergenic
1185903226 X:3913443-3913465 GAAGCCAGGAAAGGTAAGGCTGG + Intergenic
1185966650 X:4613558-4613580 AAAGAGAGGAATTTTACAGCCGG + Intergenic
1186132124 X:6479073-6479095 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186149930 X:6664209-6664231 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1186329200 X:8514189-8514211 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186598242 X:11007595-11007617 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186803578 X:13117393-13117415 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1186857101 X:13636989-13637011 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1186994483 X:15105574-15105596 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1187122508 X:16423066-16423088 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1187433773 X:19248463-19248485 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1187669108 X:21650997-21651019 GCAGGCAGGCATTTTGAAGCAGG + Intronic
1187685084 X:21808040-21808062 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1187813662 X:23208002-23208024 GAAGTCAGGTATTAAAAAGCAGG + Intergenic
1188255826 X:27960986-27961008 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188256240 X:27965176-27965198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1188315089 X:28663451-28663473 GGATCCAGTAATTTTAAAACGGG + Intronic
1188753047 X:33926797-33926819 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188776479 X:34226295-34226317 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1188809107 X:34630600-34630622 AAAGCCAAAAATTTTAAAGATGG + Intronic
1188822879 X:34796964-34796986 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188823614 X:34803330-34803352 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188849573 X:35115064-35115086 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188968802 X:36587475-36587497 GGAACCTGAAATTTTAAAGCAGG - Intergenic
1188979371 X:36713366-36713388 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1189064881 X:37796868-37796890 GGAGCCAGGCAGTCTAAAGCAGG + Intronic
1189509567 X:41648583-41648605 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1189523095 X:41790947-41790969 GTAGGAAGGAATTTGAAAGCAGG + Intronic
1189557551 X:42161436-42161458 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1189973211 X:46438574-46438596 CAAGCTAGGATTTTGAAAGCAGG - Intergenic
1189978928 X:46489776-46489798 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1190002058 X:46698332-46698354 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1190152739 X:47961837-47961859 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1190166661 X:48078705-48078727 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1190185954 X:48234423-48234445 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1190616351 X:52236887-52236909 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1190651418 X:52572235-52572257 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1191147586 X:57184420-57184442 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1191148446 X:57193613-57193635 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1191161111 X:57330701-57330723 AAAGAAAGAAATTTTAAAGCTGG - Intronic
1191191569 X:57673925-57673947 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1191226306 X:58048121-58048143 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1191244827 X:58218975-58218997 AAAGAGAGAAATTTTAAAGCAGG + Intergenic
1191248770 X:58248750-58248772 GAACCCAGGCATTCTAAAGATGG + Intergenic
1191596105 X:62945858-62945880 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191654476 X:63581251-63581273 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191721946 X:64238532-64238554 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191803062 X:65102780-65102802 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191925997 X:66310636-66310658 GAAGCCAGGAGTTCAAAACCAGG - Intergenic
1192059679 X:67811465-67811487 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1192077686 X:68017008-68017030 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1192752169 X:74004840-74004862 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1192753878 X:74024973-74024995 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1193025782 X:76844347-76844369 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG + Intergenic
1193100623 X:77607498-77607520 GAGGCCAGGAATTCAAGAGCAGG + Intronic
1193224679 X:78968677-78968699 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1193300686 X:79885444-79885466 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1193388425 X:80897778-80897800 GAAGCCAGGAGTTTGAAACCTGG + Intergenic
1193433315 X:81438990-81439012 GCAGCCAGCAAATATAAAGCAGG - Intergenic
1193540592 X:82767125-82767147 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1193594796 X:83432945-83432967 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1193708466 X:84851762-84851784 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1193980235 X:88173886-88173908 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1193994193 X:88344692-88344714 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1194042314 X:88956633-88956655 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1194102030 X:89717588-89717610 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194194997 X:90881878-90881900 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194455508 X:94098420-94098442 GAATCCAGGAAATTGACAGCAGG - Intergenic
1194800825 X:98270062-98270084 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194923315 X:99794305-99794327 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195128771 X:101835012-101835034 AAAGAGAGGAATTTTACAGCTGG + Intronic
1195462149 X:105139599-105139621 GAAGCCAGCAATTTGCAACCTGG - Intronic
1195551314 X:106174832-106174854 GAAGTCAGGAGTTTTAGACCAGG + Intronic
1195556803 X:106235976-106235998 AAAGAGAGGAATTTTACAGCGGG - Intergenic
1195734348 X:107997445-107997467 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195806225 X:108770315-108770337 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1195823166 X:108969420-108969442 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195838373 X:109144621-109144643 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195981481 X:110582849-110582871 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1195999423 X:110765269-110765291 AAAGAGAGGAATTTTACAGCTGG - Intronic
1196238054 X:113306127-113306149 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1196243342 X:113369346-113369368 GAAGACAGTGATTTTAAAGGAGG + Intergenic
1196713407 X:118787226-118787248 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1197016311 X:121630748-121630770 GAAGCCAGGTTTTTTACTGCTGG + Intergenic
1197071713 X:122306623-122306645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197113265 X:122801031-122801053 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197242458 X:124134536-124134558 GAAGGCATGAATTTGAAAGCAGG + Intronic
1197473934 X:126896839-126896861 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1197542122 X:127776811-127776833 AAAGACAAGAATTTTACAGCTGG - Intergenic
1197628677 X:128832714-128832736 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1197630707 X:128854260-128854282 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197813140 X:130467172-130467194 GAGGCCATGCATTCTAAAGCTGG - Intergenic
1197817406 X:130512504-130512526 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1197938579 X:131765139-131765161 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1198072634 X:133164649-133164671 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1198556417 X:137798338-137798360 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1198912496 X:141629960-141629982 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1198994765 X:142561548-142561570 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1198996549 X:142579571-142579593 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1199107716 X:143890418-143890440 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1199321323 X:146442536-146442558 AAAGTGAGAAATTTTAAAGCTGG - Intergenic
1199337767 X:146640485-146640507 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199360732 X:146915505-146915527 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1199476957 X:148256628-148256650 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
1199604367 X:149564928-149564950 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199746080 X:150772591-150772613 GGATCCAGGCATTTTAAAACAGG + Intronic
1199884249 X:152003277-152003299 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199989303 X:152976389-152976411 AAAGAGAGGAATTTTATAGCTGG + Intergenic
1200021238 X:153211613-153211635 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1200356369 X:155556420-155556442 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1200393076 X:155963985-155964007 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1200541618 Y:4464288-4464310 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1200617571 Y:5398689-5398711 AAAGCAAGAAATTTTACAGCAGG - Intronic
1200950508 Y:8894198-8894220 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1201342967 Y:12953850-12953872 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1201427908 Y:13874541-13874563 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1201478434 Y:14410398-14410420 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1201497059 Y:14599438-14599460 GCTGCCAGAAATTATAAAGCAGG - Intronic
1201616708 Y:15908591-15908613 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1201778064 Y:17688064-17688086 GAAGAGAGAAATTTTAAAGATGG - Intergenic
1201823493 Y:18217928-18217950 GAAGAGAGAAATTTTAAAGATGG + Intergenic
1201856060 Y:18544507-18544529 GAGGCCAGGAATTTTGAACCTGG + Intergenic
1201860493 Y:18592334-18592356 AAAGAGAGGAATTTTACAGCTGG - Intergenic
1201872830 Y:18728047-18728069 AAAGAGAGGAATTTTACAGCTGG + Intergenic
1201877261 Y:18775878-18775900 GAGGCCAGGAATTTTGAACCTGG - Intronic
1201913042 Y:19152986-19153008 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1201913225 Y:19154969-19154991 GAAGTCAGGAATTTGAGACCAGG - Intergenic
1202132673 Y:21628122-21628144 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202247399 Y:22833935-22833957 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202328824 Y:23722929-23722951 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1202340411 Y:23858627-23858649 AAAGAGAGAAATTTTAAAGCAGG - Intergenic
1202400387 Y:24467683-24467705 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202470393 Y:25202403-25202425 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1202530355 Y:25811455-25811477 AAAGAGAGAAATTTTAAAGCAGG + Intergenic
1202541947 Y:25947125-25947147 AAAGAGAGAAATTTTAAAGCTGG + Intergenic