ID: 1100442350

View in Genome Browser
Species Human (GRCh38)
Location 12:94628450-94628472
Sequence GTGCCTGTCATTGGTAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100442350_1100442357 15 Left 1100442350 12:94628450-94628472 CCAGAGCTACCAATGACAGGCAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1100442357 12:94628488-94628510 CAAGAGGTCTCAGGCAGCAAAGG 0: 1
1: 0
2: 3
3: 23
4: 167
1100442350_1100442354 -1 Left 1100442350 12:94628450-94628472 CCAGAGCTACCAATGACAGGCAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1100442354 12:94628472-94628494 CACGGGTTCAATTCTCCAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 95
1100442350_1100442358 16 Left 1100442350 12:94628450-94628472 CCAGAGCTACCAATGACAGGCAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1100442358 12:94628489-94628511 AAGAGGTCTCAGGCAGCAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 247
1100442350_1100442355 6 Left 1100442350 12:94628450-94628472 CCAGAGCTACCAATGACAGGCAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1100442355 12:94628479-94628501 TCAATTCTCCAAGAGGTCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100442350 Original CRISPR GTGCCTGTCATTGGTAGCTC TGG (reversed) Intronic
903236446 1:21953525-21953547 GTGCCTCTCATTGGGGCCTCTGG + Intergenic
903796999 1:25936835-25936857 GTGCCTGTCTCTGGTAGCAGTGG + Intergenic
905621466 1:39451825-39451847 GTGGCTGTAAATGCTAGCTCAGG - Intronic
910207604 1:84763734-84763756 GTTCCTGTCATCCATAGCTCGGG + Intergenic
923401478 1:233619325-233619347 GTTCCTGCCATTGGTAACCCTGG + Intronic
923929307 1:238675427-238675449 GTGCCAGTCAGTGGTTGCCCAGG + Intergenic
1073429346 10:103476284-103476306 GTGCCTGTCACAGGTAACTGGGG - Exonic
1076478389 10:130768075-130768097 GTGCCTGGCATGGGTACATCTGG - Intergenic
1080279079 11:30535773-30535795 GTGCCTGGCCTTGGTGGCTCTGG - Intronic
1089070476 11:115695961-115695983 GTGTCTGTCCTTGGGGGCTCAGG + Intergenic
1089306399 11:117529021-117529043 GTGCCTGACACAGGAAGCTCTGG - Intronic
1091835956 12:3585920-3585942 GTGGCTGTGATTGGAAGCTAAGG + Intronic
1093036832 12:14339903-14339925 GTGTCTGCTCTTGGTAGCTCAGG - Intergenic
1100167103 12:91928566-91928588 GTGCCTTACATTTGTACCTCTGG - Intergenic
1100442350 12:94628450-94628472 GTGCCTGTCATTGGTAGCTCTGG - Intronic
1101411161 12:104469694-104469716 GTGGCTGGCATTTGTAGCTGGGG + Intronic
1101589065 12:106110446-106110468 GTGCATTTCTTTGGTAGCCCTGG - Intronic
1107306075 13:39021150-39021172 GTGCCTGTCAGAGGTAGGGCAGG - Intronic
1110144439 13:72172187-72172209 GTGTCTGTCATATCTAGCTCTGG + Intergenic
1111327214 13:86714691-86714713 GTGCCTGTCGGTGGTACGTCAGG - Intergenic
1112897246 13:104314789-104314811 GTGCCTGTCATTGCTAAGTTTGG - Intergenic
1114473198 14:22977812-22977834 ATGCCTGCCACTGTTAGCTCAGG - Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1119903228 14:78279643-78279665 GAGCTTGTCAGTGGTAGCACTGG + Intronic
1121245583 14:92459042-92459064 GTGCGGGGCAGTGGTAGCTCTGG - Intronic
1129303665 15:74642360-74642382 ATGTCAGTCATTGGTATCTCAGG + Intronic
1131157664 15:90084959-90084981 GAGCCTGTCCTGGGCAGCTCCGG + Intronic
1135774305 16:25242993-25243015 GGGCCTGTCACTAGTAACTCAGG - Intronic
1139754835 16:69133842-69133864 CTGCCTGTCATTGGAAACTGAGG + Intronic
1140594933 16:76397333-76397355 TCTCCTGACATTGGTAGCTCGGG - Intronic
1141706839 16:85670276-85670298 GTGCCTCTCTTTGGCAGCACTGG - Intronic
1144276051 17:13668675-13668697 GTGCCTGTCCTTGGGATCTAGGG - Intergenic
1151223489 17:72631386-72631408 CTTCCTGTCCTTTGTAGCTCAGG - Intergenic
1152070656 17:78132215-78132237 GTGACTGTCAGCGGTACCTCCGG + Intronic
1152102341 17:78309400-78309422 GTCCCTGTCCTGGGTACCTCTGG + Intergenic
1155740900 18:29286364-29286386 GTGCCTGTCATTTGCAGGTCAGG - Intergenic
1158613734 18:58967293-58967315 GTGACTGTCATAGGTGGCCCTGG + Intronic
1160522769 18:79518262-79518284 GTGCCTGTCATTGGACGCAGCGG - Intronic
1164249252 19:23462679-23462701 GTACCTGTCATTCTAAGCTCAGG - Intergenic
1166268231 19:41697744-41697766 GTGCCTGTCCTTGAGAACTCGGG + Intronic
927400450 2:22704367-22704389 GTGCTTGTCATTGGGCTCTCAGG - Intergenic
927879914 2:26683022-26683044 CTCTCTGTCATTGATAGCTCTGG + Intergenic
928691538 2:33804653-33804675 TTACCTGTCATTGCTAGCTCTGG + Intergenic
930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG + Intergenic
935358366 2:102225881-102225903 TTTGCTGTCATTTGTAGCTCCGG + Exonic
935594851 2:104870395-104870417 GTGCTTGTCACTAGCAGCTCAGG + Intergenic
938108254 2:128547757-128547779 GACCCTGTCATTAGCAGCTCTGG + Intergenic
1170128981 20:12998433-12998455 GTGCCTCTCATTTGTTGCTCTGG - Intergenic
1172698355 20:36837288-36837310 CTGCCTGTCTTCGGAAGCTCTGG - Intronic
1179358445 21:40683181-40683203 GTTCCTGTATTTGGCAGCTCTGG - Intronic
1180986664 22:19908288-19908310 TTCCCTGTCCTTGGTAACTCAGG - Intronic
1182083286 22:27543988-27544010 GAGCCTGTCCTTGGTCTCTCTGG - Intergenic
1182570063 22:31230315-31230337 GAGCATGTCATTTGTAGCTGAGG + Intronic
1183345339 22:37304335-37304357 GAGGCTGTCATTGGAAGCCCTGG - Intronic
1183501931 22:38185453-38185475 CTGCCTCTCATTGGCAACTCTGG - Intronic
1184472601 22:44704263-44704285 GTGGCTGTCAGTGGGTGCTCAGG - Intronic
950430000 3:12945151-12945173 GTGCCTGGCGCTGGTAGTTCAGG + Intronic
954493848 3:50933952-50933974 GTGGCTGTCTTTTGTGGCTCTGG + Intronic
957566823 3:81894748-81894770 CTTCCTGTCATTCGTAACTCAGG - Intergenic
959342099 3:105144596-105144618 CTGCCTGACATTGCAAGCTCTGG - Intergenic
961934690 3:130570847-130570869 GTGTTTGTCATTGATAGCTCTGG + Exonic
963286458 3:143438779-143438801 GGGCCAGTCACTGGTAACTCGGG - Intronic
964444691 3:156746547-156746569 GTGTCTGTAACTGGTAGCACTGG + Intergenic
966625311 3:182009359-182009381 TTGCCTCTCATTAGTATCTCAGG - Intergenic
969329246 4:6463551-6463573 GTGCCTGTCCTGGGCAGCACAGG + Intronic
971421166 4:26475357-26475379 GAGCCTTTCACTGGTCGCTCTGG + Intergenic
973933158 4:55814107-55814129 GAGCCTGTCATTGATAGTGCTGG + Intergenic
974622825 4:64384132-64384154 GTGCCAGTCATTGGGTGCCCAGG + Intronic
976388127 4:84483087-84483109 GTGCCCGGCATGGGAAGCTCAGG + Intergenic
995569063 5:113460179-113460201 ATGACTGTCATGGGTAGCTTTGG + Intronic
995679401 5:114700108-114700130 GTGCCTGTCCATGGTAGGACAGG + Intergenic
995740453 5:115350459-115350481 GTGCCTCTCCTTGGTGGCTGTGG - Intergenic
998141402 5:139701539-139701561 GTGTCTGTCATTCGAAGCTGAGG + Intergenic
998610455 5:143682661-143682683 CTGCCTGTCATTAAGAGCTCTGG + Intergenic
1007794503 6:44336941-44336963 GTGCCTGAAATTGGTACCTGGGG - Intronic
1007970343 6:46045885-46045907 GTTCCAGTCATTGGAAGCACTGG + Intronic
1008635515 6:53406737-53406759 GTGTCTTTCATTGGTGGCTGGGG - Intergenic
1013597272 6:111671646-111671668 GTGCCTGTTGCTGGTACCTCAGG - Intronic
1015326572 6:131930453-131930475 GTGTCTTTCTTTGGAAGCTCGGG + Intergenic
1019603174 7:1895429-1895451 GGGCCTGGCATGGGGAGCTCTGG - Intronic
1024973687 7:55093882-55093904 GTAACTGTCACTGGTAGCTCAGG + Intronic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1039327928 8:36505105-36505127 GTGGCTGTCATCGGGAGCTGAGG - Intergenic
1045208767 8:100072380-100072402 GTGCCTCACATTTGTGGCTCAGG - Intronic
1048579128 8:135716466-135716488 GCTCCTGTCTTTGTTAGCTCAGG - Intergenic
1054825840 9:69572630-69572652 GTGCCTGTCTTTGGGAGTCCTGG + Intronic
1055033206 9:71791402-71791424 CTGCCTGTCATTACCAGCTCCGG - Intronic
1060679389 9:125547680-125547702 CTGCCTGTCATTGGTAACACAGG + Intronic
1061002652 9:127911011-127911033 GAGCCTGTCATGGGAAGATCTGG + Intronic
1188934742 X:36160371-36160393 TAGCCTGTCATTGGTGGTTCTGG + Intergenic
1189267479 X:39728130-39728152 ATGCCTGTCCTTGTTACCTCCGG - Intergenic
1191865619 X:65701397-65701419 GTTCCTGTCATGGGGATCTCTGG + Intronic
1195102947 X:101573925-101573947 GGGCCTGGCATTGGCAGGTCTGG + Intergenic
1196270418 X:113704138-113704160 GTACATGTAATTGGTATCTCAGG - Intergenic
1196745031 X:119064006-119064028 GTGCCTGACAATGGTTGCTAAGG + Intergenic