ID: 1100445553

View in Genome Browser
Species Human (GRCh38)
Location 12:94656603-94656625
Sequence TAGGATAAGGCTTCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100445553_1100445560 11 Left 1100445553 12:94656603-94656625 CCAGCCTCAGAAGCCTTATCCTA No data
Right 1100445560 12:94656637-94656659 GCTGCTCTTTTCTCTCCTGAAGG No data
1100445553_1100445561 15 Left 1100445553 12:94656603-94656625 CCAGCCTCAGAAGCCTTATCCTA No data
Right 1100445561 12:94656641-94656663 CTCTTTTCTCTCCTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100445553 Original CRISPR TAGGATAAGGCTTCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr