ID: 1100448966

View in Genome Browser
Species Human (GRCh38)
Location 12:94687093-94687115
Sequence CTGGGGATAAGGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100448963_1100448966 -10 Left 1100448963 12:94687080-94687102 CCATGTAGTGCTGCTGGGGATAA No data
Right 1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG No data
1100448959_1100448966 6 Left 1100448959 12:94687064-94687086 CCAGGAGGTTTAATTACCATGTA No data
Right 1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100448966 Original CRISPR CTGGGGATAAGGAAGGATGA TGG Intergenic
No off target data available for this crispr