ID: 1100451457

View in Genome Browser
Species Human (GRCh38)
Location 12:94710921-94710943
Sequence CTGTATCTACAGAGAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100451452_1100451457 16 Left 1100451452 12:94710882-94710904 CCAAAGTCAGATCAACGAAGAAC No data
Right 1100451457 12:94710921-94710943 CTGTATCTACAGAGAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100451457 Original CRISPR CTGTATCTACAGAGAAGGGG AGG Intergenic
No off target data available for this crispr