ID: 1100459033

View in Genome Browser
Species Human (GRCh38)
Location 12:94780372-94780394
Sequence CCTCCCAGGACCCCACAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459024_1100459033 27 Left 1100459024 12:94780322-94780344 CCTACATAGCGCCAGGCGCTACG No data
Right 1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG No data
1100459025_1100459033 16 Left 1100459025 12:94780333-94780355 CCAGGCGCTACGAGAAGTTTAAC No data
Right 1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459033 Original CRISPR CCTCCCAGGACCCCACAACC TGG Intergenic
No off target data available for this crispr