ID: 1100459479

View in Genome Browser
Species Human (GRCh38)
Location 12:94784998-94785020
Sequence ATAAAGTAGCTGGGCAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459475_1100459479 29 Left 1100459475 12:94784946-94784968 CCTGGACTACAGGGCAAGACCTT No data
Right 1100459479 12:94784998-94785020 ATAAAGTAGCTGGGCAAAAAAGG No data
1100459476_1100459479 10 Left 1100459476 12:94784965-94784987 CCTTATCTCTAAAAAAGTAAAAT No data
Right 1100459479 12:94784998-94785020 ATAAAGTAGCTGGGCAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459479 Original CRISPR ATAAAGTAGCTGGGCAAAAA AGG Intergenic
No off target data available for this crispr