ID: 1100459746

View in Genome Browser
Species Human (GRCh38)
Location 12:94787675-94787697
Sequence CCACATTTGTTTCCATGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459746_1100459750 -2 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459750 12:94787696-94787718 GGTATGTACATACAGTGGAAGGG No data
1100459746_1100459748 -7 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459748 12:94787691-94787713 AATGTGGTATGTACATACAGTGG No data
1100459746_1100459749 -3 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459746 Original CRISPR CCACATTTGTTTCCATGTGT AGG (reversed) Intergenic
No off target data available for this crispr