ID: 1100459748

View in Genome Browser
Species Human (GRCh38)
Location 12:94787691-94787713
Sequence AATGTGGTATGTACATACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459744_1100459748 17 Left 1100459744 12:94787651-94787673 CCTTACATGACTGTGTGCAGGTT No data
Right 1100459748 12:94787691-94787713 AATGTGGTATGTACATACAGTGG No data
1100459746_1100459748 -7 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459748 12:94787691-94787713 AATGTGGTATGTACATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459748 Original CRISPR AATGTGGTATGTACATACAG TGG Intergenic
No off target data available for this crispr