ID: 1100459749

View in Genome Browser
Species Human (GRCh38)
Location 12:94787695-94787717
Sequence TGGTATGTACATACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459746_1100459749 -3 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG No data
1100459744_1100459749 21 Left 1100459744 12:94787651-94787673 CCTTACATGACTGTGTGCAGGTT No data
Right 1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459749 Original CRISPR TGGTATGTACATACAGTGGA AGG Intergenic
No off target data available for this crispr