ID: 1100459750

View in Genome Browser
Species Human (GRCh38)
Location 12:94787696-94787718
Sequence GGTATGTACATACAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100459746_1100459750 -2 Left 1100459746 12:94787675-94787697 CCTACACATGGAAACAAATGTGG No data
Right 1100459750 12:94787696-94787718 GGTATGTACATACAGTGGAAGGG No data
1100459744_1100459750 22 Left 1100459744 12:94787651-94787673 CCTTACATGACTGTGTGCAGGTT No data
Right 1100459750 12:94787696-94787718 GGTATGTACATACAGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100459750 Original CRISPR GGTATGTACATACAGTGGAA GGG Intergenic
No off target data available for this crispr