ID: 1100459750 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:94787696-94787718 |
Sequence | GGTATGTACATACAGTGGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1100459746_1100459750 | -2 | Left | 1100459746 | 12:94787675-94787697 | CCTACACATGGAAACAAATGTGG | No data | ||
Right | 1100459750 | 12:94787696-94787718 | GGTATGTACATACAGTGGAAGGG | No data | ||||
1100459744_1100459750 | 22 | Left | 1100459744 | 12:94787651-94787673 | CCTTACATGACTGTGTGCAGGTT | No data | ||
Right | 1100459750 | 12:94787696-94787718 | GGTATGTACATACAGTGGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1100459750 | Original CRISPR | GGTATGTACATACAGTGGAA GGG | Intergenic | ||
No off target data available for this crispr |