ID: 1100460180

View in Genome Browser
Species Human (GRCh38)
Location 12:94791683-94791705
Sequence GTGTTCTCATTGTTCAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100460180_1100460192 28 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460192 12:94791734-94791756 CTGGGGCATGTCAGGGAGTCAGG No data
1100460180_1100460185 -8 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460185 12:94791698-94791720 GAGAACACATGGACACAGGGAGG 0: 5159
1: 17334
2: 16705
3: 6892
4: 3305
1100460180_1100460191 21 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460191 12:94791727-94791749 TCACACACTGGGGCATGTCAGGG 0: 12
1: 1131
2: 2890
3: 6311
4: 8422
1100460180_1100460188 10 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460188 12:94791716-94791738 GGAGGGAAACATCACACACTGGG 0: 125
1: 2127
2: 8537
3: 19892
4: 14050
1100460180_1100460193 29 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460193 12:94791735-94791757 TGGGGCATGTCAGGGAGTCAGGG No data
1100460180_1100460186 -7 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460186 12:94791699-94791721 AGAACACATGGACACAGGGAGGG 0: 5232
1: 15927
2: 17456
3: 8454
4: 4980
1100460180_1100460187 9 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460187 12:94791715-94791737 GGGAGGGAAACATCACACACTGG 0: 159
1: 2935
2: 10491
3: 13062
4: 9338
1100460180_1100460190 20 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460190 12:94791726-94791748 ATCACACACTGGGGCATGTCAGG 0: 15
1: 1104
2: 2657
3: 3674
4: 3316
1100460180_1100460189 11 Left 1100460180 12:94791683-94791705 CCCTTGTTGAACAATGAGAACAC No data
Right 1100460189 12:94791717-94791739 GAGGGAAACATCACACACTGGGG 0: 125
1: 2107
2: 7727
3: 17760
4: 16155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100460180 Original CRISPR GTGTTCTCATTGTTCAACAA GGG (reversed) Intergenic
No off target data available for this crispr