ID: 1100460393

View in Genome Browser
Species Human (GRCh38)
Location 12:94793667-94793689
Sequence ACCAAATGGTCTCCCTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100460391_1100460393 -6 Left 1100460391 12:94793650-94793672 CCAGCAATAGAAACAAAACCAAA No data
Right 1100460393 12:94793667-94793689 ACCAAATGGTCTCCCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100460393 Original CRISPR ACCAAATGGTCTCCCTGTAA TGG Intergenic
No off target data available for this crispr