ID: 1100460506

View in Genome Browser
Species Human (GRCh38)
Location 12:94794770-94794792
Sequence ATGCTGTTAATAATGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100460504_1100460506 9 Left 1100460504 12:94794738-94794760 CCTAATTGAGACACTTGTGGGAA No data
Right 1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG No data
1100460501_1100460506 25 Left 1100460501 12:94794722-94794744 CCATATAACTTACTGTCCTAATT No data
Right 1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100460506 Original CRISPR ATGCTGTTAATAATGACACA AGG Intergenic
No off target data available for this crispr