ID: 1100461192

View in Genome Browser
Species Human (GRCh38)
Location 12:94800838-94800860
Sequence GCGACTTGCCCGAGATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100461192_1100461194 18 Left 1100461192 12:94800838-94800860 CCATGGGATCTCGGGCAAGTCGC No data
Right 1100461194 12:94800879-94800901 GTTGTTCATCCATAAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100461192 Original CRISPR GCGACTTGCCCGAGATCCCA TGG (reversed) Intergenic
No off target data available for this crispr