ID: 1100461575

View in Genome Browser
Species Human (GRCh38)
Location 12:94804879-94804901
Sequence GTGTATAGAAACATTTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100461572_1100461575 -4 Left 1100461572 12:94804860-94804882 CCCGCATCTACAAGGATAGGTGT No data
Right 1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG No data
1100461573_1100461575 -5 Left 1100461573 12:94804861-94804883 CCGCATCTACAAGGATAGGTGTA No data
Right 1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100461575 Original CRISPR GTGTATAGAAACATTTTGCT GGG Intergenic
No off target data available for this crispr