ID: 1100468360

View in Genome Browser
Species Human (GRCh38)
Location 12:94869233-94869255
Sequence GGCTACTTACTGACTAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100468360_1100468362 -10 Left 1100468360 12:94869233-94869255 CCCGCTCTAGTCAGTAAGTAGCC No data
Right 1100468362 12:94869246-94869268 GTAAGTAGCCTTCAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100468360 Original CRISPR GGCTACTTACTGACTAGAGC GGG (reversed) Intergenic
No off target data available for this crispr