ID: 1100471365

View in Genome Browser
Species Human (GRCh38)
Location 12:94896319-94896341
Sequence AAGCAGAACCAGAATAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100471361_1100471365 3 Left 1100471361 12:94896293-94896315 CCAAAAGCTGGCAGCTGTGTCCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100471365 Original CRISPR AAGCAGAACCAGAATAGGGA AGG Intergenic
901835695 1:11922730-11922752 ACGCTGAACCAGAAGAGGAAGGG + Exonic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
905470025 1:38184950-38184972 TACCAGGACCAGAATAGGGTGGG + Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
906591853 1:47032087-47032109 AAAGAAAACAAGAATAGGGATGG - Intronic
906728875 1:48064286-48064308 AAGCAAAACCAAAACAGAGAAGG - Intergenic
906900944 1:49835900-49835922 AGCCAGAACCAGAAGAGGGTGGG - Intronic
907797699 1:57733875-57733897 AAGAAGAAGCAGCACAGGGAAGG + Intronic
908220756 1:62003741-62003763 AAGGAGTACCAGGCTAGGGATGG - Intronic
908404906 1:63805211-63805233 AAGCAGCACCTGATCAGGGAGGG + Intronic
908511612 1:64854203-64854225 AAGCAGCACCAGGATAGAAAGGG - Intronic
909252649 1:73378847-73378869 AAGCAGAAACAGAATAAAAAGGG + Intergenic
910765690 1:90779968-90779990 AGGCAAAACTAGAATAGGGGTGG + Intergenic
911228741 1:95336986-95337008 AAGCAGAGCCAGAGCAGGGCAGG - Intergenic
911396164 1:97313596-97313618 AATGAGAAACAGAATAGAGAAGG - Intronic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912563386 1:110566317-110566339 AAGCAGAGGCAGAGTAGTGAAGG + Intergenic
914884653 1:151574990-151575012 AAGCAGAACGAGAAAAGTAAGGG + Exonic
914998439 1:152565232-152565254 AAGCAGAATCAAAAGATGGAGGG - Intronic
916193371 1:162200114-162200136 AAGCAGTCCCAGGAAAGGGATGG - Intronic
916611571 1:166396866-166396888 AAGCAGGGCCAGAGAAGGGAGGG + Intergenic
917164891 1:172100789-172100811 GAGCAGAACAAAAATATGGAAGG - Intronic
917453815 1:175168907-175168929 AAGCAGAGAGAGAACAGGGAGGG - Intronic
917650796 1:177075535-177075557 AAGCTGAACCTGAATTTGGAGGG + Intronic
918199559 1:182254518-182254540 CTGCAGAACCAGAAGAGGAAAGG + Intergenic
918991256 1:191699774-191699796 AAGCAGGACAAAAGTAGGGAGGG + Intergenic
919835707 1:201571728-201571750 AAACAGAACCAAATTAGGAAGGG - Intergenic
920068469 1:203286055-203286077 AAGCAGACCTAGAAGTGGGATGG - Intergenic
920115074 1:203614976-203614998 AAAAAAAAACAGAATAGGGATGG + Intergenic
920697119 1:208189406-208189428 CAGGAGGCCCAGAATAGGGAGGG + Intronic
920704206 1:208240014-208240036 AGACAGAACCAGAGCAGGGAAGG + Intronic
921336314 1:214090298-214090320 AAGAAGAACCTGAATAGCCATGG - Intergenic
924150437 1:241124101-241124123 AAGAAGAACCAGGATGGGCATGG + Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
924687970 1:246315412-246315434 AAGCAGGACCTCAATAGAGAGGG + Intronic
1064464218 10:15563061-15563083 AAGCAGAACCAAGAGAGAGAGGG - Intronic
1065386259 10:25136381-25136403 AAGAATAACCTGAAAAGGGAGGG - Intergenic
1065935161 10:30514754-30514776 AATAAGAACTAGAATAGGGGTGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067232493 10:44421881-44421903 GAGGAGGACCAGAACAGGGAGGG + Intergenic
1067724360 10:48757893-48757915 AACCACAACAAAAATAGGGAAGG - Intronic
1069253798 10:66306331-66306353 AAGAAGACTCAGAACAGGGAAGG - Intronic
1069349931 10:67513201-67513223 AAGGAGTACCAGAATGGGTATGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1071688737 10:87792462-87792484 AAGCAAAATCAGCAAAGGGAAGG - Intronic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074392253 10:113068294-113068316 AAGCAGTGCAAGAATAGAGACGG - Intronic
1074594927 10:114853954-114853976 AAGGAGAATCTGAAGAGGGAAGG + Intronic
1074924825 10:118057387-118057409 AAGCAGAACAGGAGTAGGCAGGG - Intergenic
1075793725 10:125104002-125104024 TAGCTGAACCGGAAGAGGGAAGG + Intronic
1076046704 10:127300063-127300085 AAGCAGACCCAGCAAAGGGAAGG + Intronic
1077787624 11:5401836-5401858 AAGCAGAAGAAAAAGAGGGAAGG - Intronic
1079114266 11:17630988-17631010 TGGCAGAACCAGAAGATGGAAGG - Intronic
1079659560 11:23021417-23021439 CCCCAGTACCAGAATAGGGAGGG - Intergenic
1080601242 11:33822195-33822217 GAGCAGAAACAGAAATGGGAAGG - Intergenic
1080975947 11:37340631-37340653 GAGCATAACCAGAATAAGTATGG - Intergenic
1081193726 11:40135978-40136000 GAGCAGAACTAGAAGAGGGCTGG + Intronic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1082641676 11:55668744-55668766 AAGCAGAATCAGCCTATGGAGGG + Intergenic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1085374403 11:76045808-76045830 AAAAAGAAACAGAAAAGGGAAGG + Intronic
1086215999 11:84382169-84382191 ACGAAGAACTAGATTAGGGAGGG - Intronic
1086944128 11:92828469-92828491 AAGCATAACCAGAAAGGGGTGGG - Intronic
1087852705 11:103050949-103050971 AATCAGACCCAGAATAAGGGGGG + Intergenic
1088060648 11:105645138-105645160 AAGCTGAGCCAGAAAAGAGATGG + Intronic
1088792390 11:113237229-113237251 AGGCTGAACCAGAATAGCGGAGG + Intronic
1090488310 11:127134987-127135009 AAGCAGAAATAGAATACGAATGG + Intergenic
1091437854 12:486847-486869 AATTAGAACCAGAGTAGGTATGG + Intronic
1092075095 12:5666148-5666170 ATACAGAAACAGAATAGTGAAGG + Intronic
1092276207 12:7062692-7062714 AAGCACAAAAAGAATAGAGATGG + Intronic
1093359882 12:18210935-18210957 AATCACATCCAGAATAGTGAGGG + Intronic
1093713163 12:22350916-22350938 AACCAGAAGCAGAATTGGAATGG - Intronic
1097224611 12:57470153-57470175 ACCCAGAAACAGAATAGGCATGG + Intronic
1097426255 12:59448190-59448212 AAGCAGGAAAAGTATAGGGATGG - Intergenic
1098886953 12:75969941-75969963 AAGGAGAACCTTAAAAGGGATGG - Intergenic
1098932612 12:76437583-76437605 AAGCAGAACCAGGCAAGGGTGGG - Intronic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100705696 12:97197897-97197919 CAGCAGAACCAGAAGAGGTAAGG + Intergenic
1101299429 12:103463238-103463260 AAGGAGAACTAGAAGAGGAAGGG - Intronic
1102213024 12:111140674-111140696 AGGCAAAATCAGAATAGGGGTGG + Intronic
1102253057 12:111400567-111400589 AAGCAGGAGCAGAAGAGAGATGG + Intergenic
1105208662 13:18244363-18244385 AAGAAGAAATAGAATAGGCATGG + Intergenic
1108552140 13:51557132-51557154 AGGCAGAACCATAATACGGAAGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110809390 13:79794796-79794818 AAAAAGTACTAGAATAGGGAGGG + Intergenic
1111449634 13:88398006-88398028 AAAAAGAACCCGAATAGGTAAGG + Intergenic
1111987528 13:95080088-95080110 AAGCGGCACAGGAATAGGGAAGG - Intronic
1112397742 13:99048561-99048583 AAGAAGCACCAAAATATGGAAGG - Intronic
1112792651 13:103019743-103019765 AAGGAGTAACAGAAAAGGGACGG - Intergenic
1112903975 13:104394452-104394474 AAGCAGCACCAGAACAGAGAAGG - Intergenic
1113659351 13:112094986-112095008 AAGAAGAACAAGAGAAGGGAAGG - Intergenic
1114356425 14:21914421-21914443 GAACAGAAAGAGAATAGGGAGGG + Intergenic
1114661674 14:24350113-24350135 GAGCAGAACCAGGATAGCCAAGG + Intergenic
1115936723 14:38560751-38560773 GAGCAGAAGCAAAAGAGGGAGGG + Intergenic
1116386479 14:44336894-44336916 AATAATAACCAGAATAGGTAAGG + Intergenic
1118180390 14:63486650-63486672 AAGCAGGAACAGGATAGGAAAGG - Intronic
1119161209 14:72453805-72453827 ATGCAGAGCCACAATAGGCAGGG - Intronic
1119903760 14:78283142-78283164 AAGAAGAACGAGATTAGGGAAGG + Intronic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1125364674 15:38901348-38901370 AAACAGAACTAGAACAGGGAGGG - Intergenic
1127496274 15:59515360-59515382 AAACAGTACAAGAAAAGGGAAGG - Intronic
1128754538 15:70172432-70172454 AGTCAGGACCAGAACAGGGAAGG - Intergenic
1131893262 15:96997504-96997526 AGGCAGAGACAGAAAAGGGAAGG - Intergenic
1133169322 16:3971314-3971336 AGGCAGAATCAGCAAAGGGAAGG - Intronic
1133253075 16:4497406-4497428 AAGCAGCACCAGGAGCGGGAGGG - Intronic
1134027231 16:10963737-10963759 TAGCAAAGCCAGAATAGAGAAGG + Intronic
1134470088 16:14516976-14516998 AATCAGACACAGAAGAGGGAAGG + Intronic
1134531564 16:14988371-14988393 AAGCTGAACCAGAAGAGGAAGGG + Intronic
1134837973 16:17377667-17377689 AAACATAACCAGAATAGTCAGGG + Intronic
1137922250 16:52501933-52501955 AGGCAGCAACAGAATAGAGAAGG + Intronic
1139717874 16:68828165-68828187 CAGCAGAATCAGAACTGGGATGG - Exonic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1140747478 16:77993911-77993933 AAACAGACCCAGACTTGGGAGGG + Intergenic
1141193756 16:81843910-81843932 AAACAGAAACAGAAAAGGAAAGG - Intronic
1141794278 16:86259462-86259484 AAAGAGTACCAGAATTGGGATGG - Intergenic
1143178279 17:4968784-4968806 AAGCAGAACCAGGAGCTGGAAGG - Exonic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1150206086 17:63409052-63409074 AAACAGATCCAGAATATGAAAGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151834374 17:76573421-76573443 CACCAGAACCAGCCTAGGGAAGG - Intronic
1152814577 17:82399872-82399894 AAGCACACCCAGACCAGGGAGGG + Intronic
1154114626 18:11601553-11601575 AAGAAGAACCTGAATAGCAAAGG + Intergenic
1156317624 18:35985481-35985503 AAGGAGAACCAGTGTAGGGTGGG - Intronic
1156659333 18:39328178-39328200 AAGACGAAGGAGAATAGGGAAGG - Intergenic
1156732999 18:40218304-40218326 AAGCAGAACAAGAATATGTGGGG - Intergenic
1156909792 18:42397916-42397938 ATGCAGAACAATAAAAGGGAAGG + Intergenic
1156921903 18:42532246-42532268 GAGCAGAAACAAAGTAGGGAGGG + Intergenic
1157049969 18:44152035-44152057 AAACAGGAAGAGAATAGGGAAGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159027476 18:63197616-63197638 CAGCAGGAACAGAAAAGGGAAGG + Intronic
1159383696 18:67694756-67694778 AAGCAGAACAAGAATTCAGAAGG + Intergenic
1159605329 18:70468878-70468900 AAGAAGAATTGGAATAGGGATGG + Intergenic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1161084623 19:2329039-2329061 AAGCAGAACCGGAGGATGGAGGG - Intronic
1163048962 19:14666812-14666834 AAGCAGAACCTGAACAGGAAGGG - Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164148312 19:22526806-22526828 GAGCACAACCAGATTTGGGACGG - Intronic
1164571342 19:29376827-29376849 AGGCAGAAACAGAAAAGAGATGG + Intergenic
1165118352 19:33543181-33543203 AAACGGAACCAAAAGAGGGAGGG - Intergenic
1165733701 19:38162759-38162781 CAGCAGAGCCACAAGAGGGAGGG - Intronic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166445272 19:42853238-42853260 AAGCAGAAACAGAAGAGAGAAGG - Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
926053772 2:9761709-9761731 AAGCAGAGGCAGGAAAGGGAGGG - Intergenic
926695627 2:15768431-15768453 AAACAAAACCAGAAATGGGATGG - Intergenic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930070891 2:47365340-47365362 AAGAAGATCTAGAATAGAGAGGG + Intronic
933608150 2:84405994-84406016 AAGCAAAGCCAGAAGAGGGCTGG - Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
935204815 2:100888347-100888369 AAGCAGAAACAGAAGAGGATAGG + Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937025274 2:118692512-118692534 AGGCAGAGCCAGGATAGGAATGG - Intergenic
938367061 2:130743214-130743236 AAGCAGAACCAGGCTGGGCACGG - Intergenic
939878474 2:147603823-147603845 AAGCAGAGCAAGAATTGGAATGG - Intergenic
941749570 2:169120479-169120501 TAGAAGAACCAAAATAGGGCTGG + Intergenic
942665317 2:178311124-178311146 AGGCAGAACCAGATTATGAATGG - Intronic
943690739 2:190867302-190867324 AAGGAGCACCAGAATAGAGCAGG + Intergenic
944980585 2:205115224-205115246 AATCAGAACCAGGAAAAGGAAGG - Intronic
945919106 2:215737611-215737633 GACTAGAACCAGAAAAGGGAGGG - Intergenic
946068615 2:217011680-217011702 AACCACACTCAGAATAGGGAAGG - Intergenic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
946426735 2:219602505-219602527 AAGCAGAGCCAGCCAAGGGAGGG - Exonic
946432662 2:219633851-219633873 ACGCAGAACTGGAATAGGGCTGG - Intronic
947706614 2:232281635-232281657 AATCAGAACCACAAAAGGGAGGG + Intronic
947886230 2:233573977-233573999 AAACAGAACAAGAATAGGCTGGG + Intergenic
947912551 2:233811026-233811048 AAGCAGAGCCAAGACAGGGAAGG - Intronic
947940447 2:234049873-234049895 AAGGAGAACCAAAATATAGAGGG - Intergenic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1170103718 20:12730477-12730499 AAGCAGTACCAGTATATGCAAGG + Intergenic
1170316669 20:15049298-15049320 AAGAAGAAAGAGAAGAGGGAGGG + Intronic
1170345745 20:15384917-15384939 AAGCAGAGCCAGATTAAGGAGGG - Intronic
1170594197 20:17793100-17793122 AAGCAGGACAAGGAAAGGGAAGG + Intergenic
1173225646 20:41161104-41161126 AAGCAGACCAAGAAAAGGGCAGG + Intronic
1174483909 20:50849490-50849512 AAGCAGAGCCAGGACAGGCAGGG + Intronic
1175324096 20:58110550-58110572 GAGGGGAACCAGAACAGGGATGG - Intergenic
1178299638 21:31441519-31441541 TAGCAGAGCCACAATATGGAAGG + Intronic
1180074991 21:45457668-45457690 AAGCAGAATCTGAATGGGGCAGG - Intronic
1180767597 22:18354974-18354996 AAGAAGAAATAGAATAGGCATGG - Intergenic
1180778709 22:18507416-18507438 AAGAAGAAATAGAATAGGCATGG + Intergenic
1180811433 22:18764724-18764746 AAGAAGAAATAGAATAGGCATGG + Intergenic
1181197586 22:21198978-21199000 AAGAAGAAATAGAATAGGCATGG + Intergenic
1181395985 22:22622294-22622316 AAGAAGAAATAGAATAGGCATGG - Intergenic
1181647387 22:24240287-24240309 AAGAAGAAACAGAATAGGCATGG + Intronic
1181704166 22:24638201-24638223 AAGAAGAAATAGAATAGGCATGG - Intergenic
1183147712 22:36009945-36009967 AAGAAGTACCAGCATAGGAAAGG - Intronic
1183849122 22:40569354-40569376 AACCAGAACCAGACCAGGAATGG + Intronic
1184448709 22:44570149-44570171 AAGCAGAAAGAGAAAAGGGGAGG - Intergenic
1203229216 22_KI270731v1_random:95857-95879 AAGAAGAAATAGAATAGGCATGG - Intergenic
949691415 3:6644161-6644183 AAGCAAAACCACAATAAGAATGG + Intergenic
950170532 3:10835824-10835846 AAGCAGAAACAGGGTTGGGAGGG + Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
953048470 3:39317113-39317135 AAGAAGACCCAGGAAAGGGAAGG - Intergenic
953933642 3:47020804-47020826 AAGCAGAACCAGGAGATGGGTGG - Intronic
955912396 3:63870801-63870823 ATGCAGAAAGGGAATAGGGAAGG - Intronic
956105722 3:65816112-65816134 AATTAGAATCAGAATTGGGAGGG - Intronic
957070309 3:75562732-75562754 AGGCAGAACCAGGAAAAGGATGG + Intergenic
958667161 3:97155904-97155926 AACCAGAAGCAGAAGAGAGATGG - Intronic
961134991 3:124502132-124502154 AAACAAAAACAGAATAGGGATGG + Intronic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961223505 3:125218722-125218744 AAGGTCAACCAGAATAGGAATGG + Intergenic
961992279 3:131204870-131204892 AATCAGAAGCAGAATATTGATGG + Intronic
962559026 3:136586935-136586957 AAGAAGAGCCAGAAAATGGAGGG + Intronic
963053294 3:141161076-141161098 AAGAAGAGCCAAAATAGTGAAGG + Intergenic
964605068 3:158552267-158552289 AAGCAGCAGCAGAATAGGAGGGG - Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966924748 3:184636942-184636964 AAGGAGAGCTAGAATTGGGAGGG - Intronic
969417773 4:7072222-7072244 AAGCAGACCAAGAATAAGGCAGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971459961 4:26884488-26884510 GAAAAGAACCAGAATAGGGCTGG + Intronic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
973089484 4:46114895-46114917 AAGCGGAACTATAACAGGGAAGG + Intronic
974640564 4:64624692-64624714 AAGAAGAACCTAAAAAGGGAAGG - Intergenic
975391264 4:73820463-73820485 TAGCAGAACCAGACTGGTGAAGG - Intergenic
976494502 4:85712010-85712032 AAAAAGAAAAAGAATAGGGAGGG - Intronic
978122326 4:105094793-105094815 ACCCAAAACCAGAAGAGGGAAGG + Intergenic
978385065 4:108169876-108169898 GAGCAAAGCCAGAAGAGGGAGGG + Intergenic
978914280 4:114104800-114104822 AAGCACAGCCAGAATAGGCATGG + Intergenic
980795755 4:137680467-137680489 AAGAAGAAAAAGAAAAGGGAGGG + Intergenic
982438574 4:155406337-155406359 AAGCACAACCAGGATGGTGATGG - Intergenic
983275902 4:165616968-165616990 AAGCAGAGCCATAAAAGGCATGG + Intergenic
983554319 4:169046366-169046388 AAGCAGATCCACAAAAGGGCAGG + Intergenic
984178572 4:176451788-176451810 AAGCAAAAGCAAAATAGTGATGG + Intergenic
984504422 4:180598963-180598985 AAGAAGAGCCAAGATAGGGATGG - Intergenic
984695333 4:182773719-182773741 AAGGTGAACCAGAAAAGGGAAGG + Intronic
985527233 5:412420-412442 AAGCAGCTCCAGAAAATGGAAGG + Intronic
986139947 5:5020100-5020122 AAGCAGGATCAGAAGAGTGATGG + Intergenic
986663544 5:10080396-10080418 AAGCAGAACAAGACAAGGCAGGG + Intergenic
990148488 5:52788887-52788909 ATGCAGAACAAGAAAAGGCAGGG + Intronic
992243727 5:74796117-74796139 AAGAAGAACCTGAACAGAGAGGG - Exonic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
994026237 5:95087743-95087765 AGGCAGAGCCACAAAAGGGAAGG - Intronic
994038550 5:95230452-95230474 AAGCAGAATGAGAATAAAGATGG - Intronic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994456160 5:100010787-100010809 CATCAGAAACAGAATAGAGAAGG + Intergenic
995273392 5:110249053-110249075 AAGCAGAAAAAAAATAGTGAAGG - Intergenic
995476281 5:112551778-112551800 AAGCAGATCCAAATTAGGGGAGG + Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
998801373 5:145872928-145872950 AAGCTGAATCAGAAGAGTGATGG - Exonic
1000913932 5:167057322-167057344 CATCAGAACCAGATTAGAGATGG - Intergenic
1001465115 5:171957368-171957390 AAGCAGGAGCAGAAAAGGGGAGG + Intronic
1004189333 6:13450487-13450509 AAGCACAACCAGCAAAGAGAAGG + Intronic
1004824598 6:19405538-19405560 AAGCAGAAATAGAACAGGCATGG - Intergenic
1005483835 6:26280475-26280497 AATCAGAACCAAAGCAGGGAGGG + Intergenic
1006202728 6:32311091-32311113 AAGGAGAACCAGTAAAGGGGGGG - Intronic
1007040173 6:38714862-38714884 AAGCAGAACCGTACTAGAGAGGG + Intergenic
1007923914 6:45635642-45635664 AAGCAGTCCCAGAAAAGAGAAGG - Intronic
1010028491 6:71246538-71246560 AAACAGAACCAAAAGAGGAAGGG - Intergenic
1011081082 6:83490634-83490656 CAGCAGCACCACAATAGAGAGGG - Intergenic
1011133870 6:84078751-84078773 AAGCAGACCCATAAAAAGGAAGG - Intronic
1011872453 6:91912836-91912858 AAGCAGAACAAGAAGAGTGTTGG - Intergenic
1013262782 6:108462672-108462694 CAGGAGAACCAGAATAGAGCTGG + Intronic
1013284890 6:108672782-108672804 AAGCAGGAAAAGAAGAGGGAAGG - Intronic
1013653799 6:112224452-112224474 AAGCAGAGCCAGACGATGGATGG - Intronic
1014233535 6:118930471-118930493 AAGCAGGTCCAGAATATTGAGGG - Intronic
1014286783 6:119508012-119508034 AAGCAGAAGCAAAGTAGAGATGG - Intergenic
1015684947 6:135849344-135849366 AAGAAGAAACAGGAGAGGGAAGG - Intergenic
1016870311 6:148809568-148809590 TAGCAGAAACAGAACTGGGAAGG + Intronic
1017597743 6:156047221-156047243 AAGGAGGACTAGAATAGGGCAGG + Intergenic
1018684478 6:166293120-166293142 AAGGAAACCCAGAAAAGGGAAGG + Intergenic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019757008 7:2778292-2778314 AAGAACAGCCAGAATAGGGCAGG + Intronic
1021255493 7:18387241-18387263 AAATAGAACAAGAATAGTGATGG - Intronic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022647573 7:32245475-32245497 AAGCAGAACGAGGATTGGGCTGG - Intronic
1023870388 7:44260259-44260281 AACCAGAGCCAGAGGAGGGAGGG - Intronic
1024279639 7:47708980-47709002 AGGCAGGACCAGCATAGGGTGGG - Intronic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1029477567 7:100794060-100794082 AAGGAGAGCCAGACCAGGGATGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1030278461 7:107744393-107744415 CAGCAGAACCAGAGTAGGAGCGG - Intronic
1030749464 7:113212985-113213007 AAACAGAAGCAGAACAGGCAAGG + Intergenic
1031646101 7:124227983-124228005 CAGCAAAACCAGAAAAGGCAGGG - Intergenic
1031717829 7:125130432-125130454 AAGAAGGACTAGATTAGGGAGGG + Intergenic
1032879017 7:136068782-136068804 TAGCAGGACCAGAATAGCTAGGG + Intergenic
1033455903 7:141503089-141503111 TAGCAGAACCACAAAATGGAAGG + Intergenic
1034143987 7:148852149-148852171 AAGCCAAACCAGAATATGGCAGG + Intronic
1037175793 8:15944775-15944797 AAACAGAACAAAAATAGGAAAGG + Intergenic
1037244754 8:16820719-16820741 AAGAAGAACAAGACTAAGGATGG + Intergenic
1039389600 8:37167167-37167189 GAGCAGAACCAGAAGAGTGCTGG + Intergenic
1041340578 8:56841445-56841467 AAGCAGAACAATAGTAGTGAGGG + Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043476515 8:80610839-80610861 AAGCAGAAAGAGGAGAGGGAGGG - Intergenic
1044143416 8:88683317-88683339 ATACAGAAATAGAATAGGGAAGG - Intergenic
1045295104 8:100865677-100865699 TAGCAGGATCAGAATAGGAAGGG - Intergenic
1045357660 8:101403786-101403808 AATCAGAACCAGACTAGGCATGG + Intergenic
1046390372 8:113564518-113564540 AAGCAGAACTTGAACAGGAATGG - Intergenic
1048427371 8:134335343-134335365 TAGCAGTAACAGCATAGGGAAGG + Intergenic
1048672672 8:136740556-136740578 AAGCAAAACCAGAAGAGGGAGGG + Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1048874573 8:138827011-138827033 AAGCAGACGCACCATAGGGATGG - Intronic
1051563143 9:18465686-18465708 AAGCAGAAAAAGAATAGATATGG + Intergenic
1051640569 9:19221077-19221099 AAGCAGAACCAGGCTGGGCATGG + Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1052323908 9:27196723-27196745 AAGCAGGAGCAGAAGAGTGAGGG + Intronic
1052352387 9:27470758-27470780 AAACAAAGCCAGATTAGGGAAGG - Intronic
1052825728 9:33172908-33172930 AAGCCCAACCAGGATAGGGAGGG + Intergenic
1053147942 9:35724547-35724569 AAGCAGAACTAGAAAAAAGAGGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055617789 9:78091208-78091230 AATCAGAACCAAAAAATGGACGG + Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1057784868 9:98079531-98079553 AAGCAAAAACAGGATTGGGAGGG - Intronic
1057927472 9:99166092-99166114 AAGCAGAACAAGAACAGGGTTGG - Intergenic
1059058005 9:111004727-111004749 AAGCAGAAGTAGAATAGGAAAGG - Intronic
1059812641 9:117872979-117873001 AAACAGAACAGGAATGGGGAAGG + Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060304870 9:122402387-122402409 AACCAGAATCACAGTAGGGATGG + Intergenic
1060508022 9:124212907-124212929 AAACACAACCAGAAAAGAGACGG + Intergenic
1061319998 9:129823021-129823043 AGGCAGGACCAGCAAAGGGAGGG - Intronic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186315206 X:8362257-8362279 AAGCTGAAGAAGAATAGGGAGGG - Intergenic
1186809276 X:13171402-13171424 AAGCAGAACAAGTATTGGCAGGG + Intergenic
1187730880 X:22253092-22253114 TGGCAGAACCATAATATGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188315018 X:28662750-28662772 AAAAAGAACCAGAAAAGGAAGGG + Intronic
1188405866 X:29809062-29809084 AAGCAGGAGCAGAATATGGTAGG - Intronic
1189301493 X:39955765-39955787 AAGCAGAGCAAGAGAAGGGAAGG - Intergenic
1190810301 X:53876866-53876888 AAGCAGAACCAAGAGAGGGGTGG + Intergenic
1191717369 X:64203017-64203039 AAGCAGACCCAGGAATGGGAGGG - Intronic
1192941250 X:75913760-75913782 AAGCAGGAGCAAAATAGAGAAGG + Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1195310161 X:103624776-103624798 AAGCAGAAACAGAAAAGAGGAGG + Intronic
1195486618 X:105415311-105415333 AAGCAAAACCAGCATTAGGATGG + Intronic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196843755 X:119882032-119882054 AAAAAGAACCAGGAGAGGGAGGG - Intergenic
1197418433 X:126205940-126205962 AAGAAGAGCCAGAATAGCCAAGG - Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1199217544 X:145277617-145277639 AAGCAGAACAAGAAGAGTGGGGG - Intergenic
1200803837 Y:7411740-7411762 CAGCAGAGACAGAAGAGGGAAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic