ID: 1100476623

View in Genome Browser
Species Human (GRCh38)
Location 12:94941135-94941157
Sequence CTGGAATTAGGGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100476623_1100476628 -1 Left 1100476623 12:94941135-94941157 CCTTCTTCCATCCCTAATTCCAG 0: 1
1: 1
2: 2
3: 36
4: 445
Right 1100476628 12:94941157-94941179 GTCCTGTGCTCTGCCTACCCTGG 0: 1
1: 0
2: 1
3: 29
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100476623 Original CRISPR CTGGAATTAGGGATGGAAGA AGG (reversed) Intronic
901671510 1:10858765-10858787 CTGGAATTAGTGAAGGAAGCAGG + Intergenic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
902190998 1:14763169-14763191 CTGCCATTAGGAATGGGAGAGGG + Intronic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
902597781 1:17520901-17520923 CTGGAACTGGGGTTGGAAGGCGG + Intergenic
902634148 1:17724205-17724227 CTGGATGTAGGGGTGGAAGGAGG - Intergenic
902789968 1:18761006-18761028 CTGAAAGGAGGGCTGGAAGAGGG + Intergenic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
904317233 1:29673379-29673401 GAGGAGTTAGGAATGGAAGAGGG - Intergenic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
904967425 1:34386969-34386991 CTGGTATTAGAAATGAAAGAGGG + Intergenic
905142060 1:35855167-35855189 CAGGAGTGAGGGATGGAAAAGGG + Exonic
905603027 1:39270274-39270296 CTGGAATTAGGAACCAAAGAAGG - Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906291108 1:44619701-44619723 GTGGAAATAGGGAGGGATGAAGG + Intronic
907275376 1:53314020-53314042 CTTGAATAGGGGAAGGAAGAAGG - Intronic
907411232 1:54284968-54284990 CTGAAATGTGGGGTGGAAGATGG + Intronic
907892372 1:58648177-58648199 CTGGAATTGGGGATGCCAGTGGG + Intergenic
908044555 1:60154568-60154590 CTGGCACTAAGCATGGAAGAGGG + Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908346566 1:63239238-63239260 CTGGAATTAAGGATTCAACAAGG + Intergenic
908398427 1:63747459-63747481 CAGGAATCAGTGATGGAAGCAGG + Intergenic
908621673 1:65988007-65988029 CTGGAATTTGGGATAGACTATGG - Intronic
910345852 1:86236943-86236965 CTAAAATTAGTGGTGGAAGATGG + Intergenic
911947309 1:104128549-104128571 ATGAAAGTAGGGATGGAAAATGG - Intergenic
912171847 1:107110089-107110111 ATAGAAATAGGGATAGAAGATGG + Intergenic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
912699865 1:111869409-111869431 GTGGCACTGGGGATGGAAGAAGG - Intronic
912849672 1:113112017-113112039 CTGGAACTAGGGAAAGCAGAAGG - Intronic
913109969 1:115648831-115648853 CTGGAAGTTGGGATGGAATGGGG + Intronic
914508873 1:148313248-148313270 CAGGAATTAAGGAGGGAAGGAGG + Intergenic
915586645 1:156847396-156847418 CTGGCTTTAGGGGTAGAAGAGGG + Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916321291 1:163507359-163507381 CTGGAATTGGTGCTTGAAGATGG - Intergenic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916959818 1:169877702-169877724 CTGGATTCAAGGATGGGAGAGGG + Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917954025 1:180073860-180073882 CTGGAATTTGGGATGAAGGTTGG - Intronic
918055748 1:181020624-181020646 CTTGAATTAGGTTTTGAAGATGG - Intronic
919788813 1:201276987-201277009 CTAGAATTTGGGTTGGCAGAGGG + Intergenic
920069535 1:203292287-203292309 CTGGAAGTGGGGATGGAGGGTGG + Intergenic
921431334 1:215069511-215069533 ATGGAAAGAGGGAAGGAAGATGG - Intronic
921735589 1:218624010-218624032 CATGAATTGGGGATGGGAGATGG - Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922067532 1:222158546-222158568 GTGGAGCTAGGGATGGAATATGG + Intergenic
922946778 1:229523166-229523188 CTGGAAGTAGGTGTGGGAGAAGG + Intronic
923748190 1:236722933-236722955 CTGGATTTGGGGTTGGAGGAGGG + Intronic
924876847 1:248115548-248115570 GTGTTATTAGGGATGGAATAAGG + Intergenic
924946536 1:248850517-248850539 CTGGAGTCAGGGACAGAAGAGGG + Intronic
1062874681 10:933372-933394 CTGGGATTAGAGATGGGAGCCGG + Intergenic
1063109845 10:3025868-3025890 ATGGAATTAGGGTTTGAACAGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064097578 10:12435329-12435351 CTGGAGTTAGGCTTGGAATATGG - Intronic
1064353934 10:14601289-14601311 CCGGAATTAGGGATATGAGATGG + Intronic
1065145222 10:22761897-22761919 CTGGAGTTAGGGGATGAAGAGGG + Intergenic
1065829159 10:29598618-29598640 CTGAAACTAGAGATGGCAGAGGG - Intronic
1067728938 10:48794967-48794989 CAGGGATTAGGGATGGAGGGAGG + Intronic
1067945122 10:50684385-50684407 CAGGAATTGGGGATGAATGACGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070109332 10:73467797-73467819 GTGGAATCAGGGCTGGTAGAGGG + Intronic
1070154374 10:73824583-73824605 CAGGAACTAGGGAAGGCAGAAGG - Intronic
1070833757 10:79435592-79435614 CTGGAATTAGGGCTGGGGGATGG - Intronic
1070866627 10:79711257-79711279 CAGGAATTGGGGATGAATGACGG - Exonic
1070880416 10:79849378-79849400 CAGGAATTGGGGATGAATGACGG - Exonic
1071304533 10:84286818-84286840 CTGGAGTTAGGGATGGAGTAGGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071633539 10:87233480-87233502 CAGGAATTGGGGATGAATGACGG - Exonic
1071646986 10:87365696-87365718 CAGGAATTGGGGATGAATGACGG - Exonic
1071976051 10:90956477-90956499 CTGGCTTTGAGGATGGAAGAAGG + Intergenic
1072071088 10:91918211-91918233 CTGAAAGTAGAGATGAAAGAAGG - Intergenic
1074063560 10:109991386-109991408 CTGGAATTAGTGATGCAGGGTGG + Intergenic
1074202359 10:111249449-111249471 CAGGAAAGAGGGATTGAAGAAGG + Intergenic
1074591020 10:114813175-114813197 GTGGAATGAGTGATAGAAGATGG - Intergenic
1075276903 10:121102187-121102209 CAAGAATTTGAGATGGAAGAAGG - Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1076333895 10:129692187-129692209 GTTGAATTAGGGTTTGAAGAAGG + Intronic
1076701777 10:132276967-132276989 CTGGAAGGAGGAATGGAGGAGGG - Intronic
1078302817 11:10150462-10150484 ATGGGATTACTGATGGAAGAGGG + Intronic
1079319366 11:19438988-19439010 CTGGAATTGGGGAGTGGAGAGGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1083053730 11:59800000-59800022 CTGGAATTAGGAATAGAAAGGGG - Intronic
1084051409 11:66602606-66602628 CAGGAAGTAGGCATTGAAGAGGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084525789 11:69697287-69697309 CAGGGATTAGGGATGGTGGAGGG - Intergenic
1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG + Intergenic
1084576750 11:69993583-69993605 CTTGAATAAGGGATGGAGGCTGG - Intergenic
1085467339 11:76733163-76733185 GTGGATGTAGGGATGGCAGATGG + Intergenic
1086504465 11:87490096-87490118 CAGGAATGAGGAATGGTAGAAGG + Intergenic
1086992523 11:93319678-93319700 CTGGGAGTTGGTATGGAAGAGGG + Intergenic
1088989043 11:114935560-114935582 CTGGAGGTAGGTATGGAAGGAGG + Intergenic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1089668253 11:120033906-120033928 CTGGAATGAGAGGGGGAAGATGG + Intergenic
1089844509 11:121447885-121447907 CGGGAATTAGGGCAGAAAGAAGG - Intergenic
1090089430 11:123681772-123681794 CAGGAAGGAGGGAGGGAAGAAGG + Intergenic
1091647077 12:2282056-2282078 AAGGAATGAGGGAGGGAAGAAGG - Intronic
1092673363 12:10888088-10888110 CTGGCATTGAAGATGGAAGAAGG - Intronic
1092702414 12:11246944-11246966 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092711993 12:11348699-11348721 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092736780 12:11590247-11590269 CAGGAATGAGCTATGGAAGATGG + Intergenic
1092993180 12:13922957-13922979 CTGGAATAAGTGATGCTAGATGG - Intronic
1093440421 12:19189147-19189169 CTGGAACTAGGCAAGCAAGATGG + Intronic
1094386445 12:29899419-29899441 CAGGAAATAGGGGTGGAATAGGG + Intergenic
1095501884 12:42848512-42848534 CTTGCATTGGGGATGGTAGAAGG - Intergenic
1095849693 12:46788801-46788823 CTATACTTTGGGATGGAAGAAGG + Intronic
1096798341 12:54092489-54092511 CTGGAAGTTGGGCTGGAACAAGG - Intergenic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1098689276 12:73466317-73466339 ATGGAAATGGGGATGGGAGAAGG - Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099288363 12:80744049-80744071 TTGCAATTAGGGATGGAATGTGG - Intergenic
1099518811 12:83632990-83633012 CAAGATTTAGGGATTGAAGAAGG - Intergenic
1099640894 12:85282099-85282121 CAGCAATTAGGGATGGGGGAGGG - Intronic
1100204567 12:92334316-92334338 ATGAAATTAGTGATGGGAGAGGG + Intergenic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1100778897 12:98002844-98002866 ATGGAAGGAGGGAGGGAAGAGGG + Intergenic
1100793308 12:98153955-98153977 CTGAAATTAGGCTGGGAAGATGG - Intergenic
1101417894 12:104524559-104524581 ATGGAAGGAGGGATGGAAAATGG - Intronic
1101523223 12:105504109-105504131 CTGGCTTTGGGCATGGAAGAAGG + Intergenic
1101926598 12:108976980-108977002 CTGGAATTAAGGCTTGAAGGAGG - Intronic
1103775359 12:123363481-123363503 CCAGAATTAGGGATGGAATATGG - Intronic
1104145428 12:126029489-126029511 CTGGAAATAGGGATGAGAAAAGG + Intergenic
1104468372 12:129008240-129008262 CTGGCAGTAAAGATGGAAGAAGG - Intergenic
1104510474 12:129373228-129373250 TTGGAATGAGGGTTGGAAGGTGG - Intronic
1104723722 12:131061793-131061815 CAGGAGTTAGGGATGGTAGAAGG - Intronic
1105795021 13:23843144-23843166 CTGGGATGAGGAATGGAAAATGG + Intronic
1106367366 13:29094532-29094554 CTAAAATTAGGAATGAAAGAGGG - Intronic
1106596644 13:31147054-31147076 CTGGAAAGTGGGATGTAAGATGG + Intronic
1106948581 13:34856570-34856592 CTGGAATTAGGGCTTGAATTTGG - Intergenic
1107612432 13:42129454-42129476 CAGGAATTAGGAATAGAAAATGG - Intronic
1108527381 13:51297355-51297377 CTGGAATTAGGGAGGGATGAAGG + Intergenic
1109105685 13:58247621-58247643 CTTGATTTAGGGATGAAACAAGG - Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1110984365 13:81945226-81945248 ATGTAACTAGGGATGGATGATGG + Intergenic
1111200928 13:84935866-84935888 CTGGAAACCGGGATGGAAGGAGG - Intergenic
1111711138 13:91815877-91815899 GTGGCATGAGGGAAGGAAGAAGG - Intronic
1111904701 13:94241597-94241619 CTGGAATTAGCCATCAAAGATGG + Intronic
1112296681 13:98193667-98193689 CAGGAATTGGGGCTGGATGAAGG - Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1113699155 13:112370951-112370973 CTGGGATGAGTGGTGGAAGAAGG - Intergenic
1113885162 13:113655034-113655056 CTGGAACTAGGTAGGGAAGATGG - Intronic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114332429 14:21650956-21650978 CTAGAATGAGTGATAGAAGAGGG - Intergenic
1114378477 14:22174920-22174942 CAGGTATTGGGAATGGAAGAAGG + Intergenic
1115270972 14:31551960-31551982 ATGGAATTAGGAAGGGTAGAGGG + Intronic
1115776339 14:36719604-36719626 CTGGTATTAGAGTTGGAGGAAGG + Intronic
1115872093 14:37816272-37816294 CTGTTATTGGGGGTGGAAGAGGG - Intronic
1117240396 14:53826586-53826608 CTGGAATTGGGAATGGAAAGAGG + Intergenic
1117881569 14:60317896-60317918 CTTGAATGAGGGAGGAAAGAAGG + Intergenic
1118268723 14:64321270-64321292 CCGGCACTAGTGATGGAAGAGGG + Intronic
1119159503 14:72441423-72441445 ATGGAATTAGGGATCTTAGAAGG + Intronic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120235205 14:81882497-81882519 CTGGAGTTAGGGCTGGGAGCAGG + Intergenic
1120249835 14:82049902-82049924 CTGCAATGTGGTATGGAAGAAGG + Intergenic
1121284116 14:92721292-92721314 TTGGCATTGAGGATGGAAGAAGG + Intronic
1122450220 14:101799772-101799794 CTGAAATGAGGCATGGAAAATGG - Intronic
1122696500 14:103555734-103555756 CTAGACTTAGGGCTGGGAGAGGG + Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1123099330 14:105785598-105785620 CTGGAAGTAGGTCTGGAGGATGG + Intergenic
1123633134 15:22275473-22275495 ATGGAAGCAGGGATGGATGACGG - Intergenic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1126103363 15:45133093-45133115 ATGGAATCAGGGATGGAGCAGGG - Intronic
1126178474 15:45761658-45761680 CTGGAAGTAGGGATGGATGCGGG - Intergenic
1126316223 15:47372821-47372843 CTAGAATTAGCAGTGGAAGATGG - Intronic
1127332617 15:57953869-57953891 ATGGAAGAAGGGATGGAAGAAGG + Exonic
1127633427 15:60847433-60847455 CTGGAATTGGGGATGGCTGATGG + Intronic
1128738899 15:70070105-70070127 TTGGGGTTAGGGATGCAAGAGGG - Intronic
1129128530 15:73467956-73467978 CTGGCATTGAGGATGGAAGGTGG - Intronic
1130556541 15:84926851-84926873 GTGGAATTTGGGATTAAAGAAGG - Intronic
1131072970 15:89477453-89477475 CAGGAAGAAGGGATGGGAGAAGG + Intronic
1131680153 15:94713183-94713205 ATGGAATTATGGCTGGTAGATGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1134034501 16:11019258-11019280 CTTGAATTAAAGATGGATGAGGG - Intronic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1136073807 16:27804839-27804861 CTGGGATTGGGGACGGGAGAGGG + Intronic
1137026317 16:35479155-35479177 TTGAAATTGGGGATGGAAGATGG - Intergenic
1137444967 16:48526063-48526085 CTGGAACTAGGGATGGCAGGAGG - Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138966399 16:62089402-62089424 CTGGAGATAGGCATAGAAGAAGG + Intergenic
1139845266 16:69916557-69916579 CTGGACATAGGAATGGAAAATGG + Intronic
1141163669 16:81646067-81646089 ATGGAAGTATGGATGGTAGATGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141655435 16:85413459-85413481 GTGACATTAGTGATGGAAGATGG - Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1146741863 17:35292422-35292444 CTGGAATTAGATAGTGAAGATGG + Intergenic
1146927090 17:36752710-36752732 CTGGAAGGAGGGATAGAAGACGG + Intergenic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1148190052 17:45672125-45672147 CTGGAGCTGGGGTTGGAAGAGGG - Intergenic
1148552150 17:48556865-48556887 CTGGCAGAAGAGATGGAAGATGG + Intronic
1149624571 17:58071357-58071379 CTAAAATTAGGAATGAAAGAGGG + Intergenic
1149631550 17:58129385-58129407 CAGGAATCAGGCAAGGAAGAAGG - Intergenic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1150766827 17:68009002-68009024 CTGGAAGAAGTGGTGGAAGAAGG - Intergenic
1150977474 17:70104726-70104748 ATGTAAATAGGCATGGAAGAAGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151546107 17:74794158-74794180 CTGGAATCATTTATGGAAGATGG + Intronic
1152817035 17:82414103-82414125 TTGGAATGAGGGAGGGAGGATGG - Intronic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153695149 18:7632716-7632738 CTGGATTTAGGGATGGTATTTGG + Intronic
1155958573 18:31974816-31974838 ATGTTATTAGGGATGGAATAAGG + Intergenic
1158784239 18:60690162-60690184 GTGGAATTGGGTATGAAAGAAGG - Intergenic
1158869368 18:61669780-61669802 CTGGACCTAGGGATGGAAGGAGG - Intergenic
1160180707 18:76633496-76633518 CTAAAATTAGGAATGGAAGCAGG + Intergenic
1161197247 19:2993728-2993750 GTGGAATGAGGGAGGGAAGGGGG + Intronic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161750283 19:6091113-6091135 CTGGAATTAGAGAGTGATGATGG + Intronic
1162657336 19:12140785-12140807 CCGGAATTAGGGATGAGACATGG + Intronic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1166002034 19:39883249-39883271 ATGGGACTAGGGATGGAGGATGG - Intronic
1166004818 19:39899500-39899522 ATGGGACTAGGGATGGAGGATGG - Intronic
1166089393 19:40498227-40498249 CTTTAATTTGGGATGGGAGATGG - Intronic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925430621 2:3789282-3789304 CTGGAAATAGGGCAGGAAAAAGG - Intronic
925884422 2:8382221-8382243 CAAGCATCAGGGATGGAAGATGG + Intergenic
926274830 2:11395809-11395831 ATGGAATTGGGGATGCAAGAGGG + Intergenic
926656301 2:15410889-15410911 CTAGAAGTAGGTCTGGAAGATGG + Intronic
927141648 2:20135140-20135162 CAGGACTTATGGATGGGAGAGGG - Intergenic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928325374 2:30315401-30315423 ATGGACTCAGGCATGGAAGAAGG + Intronic
928325992 2:30319965-30319987 CTGGAAATGGGGCTGGTAGATGG - Intronic
928909767 2:36408013-36408035 CTGGGATTAGGTATGGAAAGAGG - Intronic
930428357 2:51240917-51240939 ATGGAATTAGGGATAAAAGGGGG - Intergenic
931683478 2:64771814-64771836 CTGGAAGAAGGGAAGGATGATGG - Intergenic
932064901 2:68544737-68544759 ATGGATTTAGTGATTGAAGAGGG + Intronic
932155676 2:69414738-69414760 CTGGAACTAGGAAGGGAAAAGGG + Intronic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
933318532 2:80743778-80743800 CTAGAATTCAGGAAGGAAGAGGG - Intergenic
934573961 2:95389061-95389083 GCGGAAATAGGGAGGGAAGAGGG + Intergenic
934890496 2:98064389-98064411 CTAAAATTAGGAATGAAAGAAGG - Intergenic
934900463 2:98155744-98155766 CTGGAATGGGTGTTGGAAGATGG + Intronic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
935987847 2:108691968-108691990 CTAAAATCAGGGATGAAAGAAGG - Intergenic
936622418 2:114114167-114114189 CTGGAAATAGGGGTGGAGAAAGG + Intergenic
937158987 2:119742267-119742289 CTGGAATTAGAGATCTGAGATGG - Intergenic
937683419 2:124668842-124668864 CTGGAATGAGGGAAGGAATGAGG + Intronic
940010878 2:149053661-149053683 CTGGAATTAGGTAGTGATGATGG - Intronic
940728718 2:157364692-157364714 GTGGAAATAGGAATGAAAGAAGG + Intergenic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
941294491 2:163719304-163719326 CTGGAATTATGGCGGTAAGAAGG + Intronic
944491988 2:200267319-200267341 CTGCAATTAGGGATAGTAGTGGG + Intergenic
945025563 2:205616611-205616633 CTGGAATGTGGGAGGGAGGAAGG - Intronic
945112797 2:206378854-206378876 CTGGGACTAGAGATGGAATAGGG + Intergenic
945824164 2:214699705-214699727 TTGGAATTTGTGATGTAAGAGGG - Intergenic
946304573 2:218848501-218848523 CTGGAAGCAGTGCTGGAAGAAGG - Intergenic
946418198 2:219551048-219551070 CTGGGATTTGGGATAGAAGGTGG + Intronic
946440006 2:219687092-219687114 CAGGAATTAGGGAAGAAAGAAGG - Intergenic
947696859 2:232197989-232198011 CTGGAATTAAGGGTAGAAGTAGG + Intronic
948109165 2:235440575-235440597 CTGGGAGGAGGGATGGAGGAAGG - Intergenic
948239666 2:236419516-236419538 GTGGAATTAGGGAAGGAACTGGG - Intronic
1169267147 20:4173780-4173802 CTTGAATCAGGGAAGGAACAGGG + Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170867440 20:20171937-20171959 GTGGAATGAGAAATGGAAGAGGG + Intronic
1170949303 20:20921610-20921632 AAGGCATTGGGGATGGAAGATGG - Intergenic
1171862464 20:30413165-30413187 CAGGAAGGAGGGAAGGAAGAAGG + Intergenic
1171982799 20:31639114-31639136 CTGGAGTTAGGCAGGGAGGAAGG - Intronic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1172681877 20:36722615-36722637 CTTGAATTAGGAATGGCAGTGGG + Intronic
1172772402 20:37389298-37389320 CTGGAATTTGGGTGGGAGGAAGG - Intronic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1173192187 20:40885253-40885275 ATGAAATACGGGATGGAAGAGGG + Intergenic
1173428218 20:42961324-42961346 TTGGAATGAGGGATAAAAGAAGG - Intronic
1174344330 20:49918758-49918780 CTAGAATTCAGGATAGAAGATGG + Intergenic
1174715780 20:52757068-52757090 CTGGGATCAGGGATGAAAGTTGG - Intergenic
1174819106 20:53712143-53712165 AGGGAAGTAGGGAGGGAAGAAGG - Intergenic
1175691491 20:61068731-61068753 CTGGCTTTGAGGATGGAAGAAGG - Intergenic
1175984117 20:62755604-62755626 ATGGAATGAGGGATGGAGGGAGG - Intronic
1175984215 20:62755880-62755902 ATGGAATGAGGGATGGAGGGAGG - Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1178768892 21:35483983-35484005 TGGGAATTAAGGATGGTAGAGGG - Intronic
1179140070 21:38717577-38717599 CTGGCTTTGAGGATGGAAGACGG + Intergenic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179366664 21:40765254-40765276 AAGGAATTGGGCATGGAAGAAGG - Intronic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1183027719 22:35078495-35078517 GTGGACTTAGGGAGGGAAGGGGG + Intronic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1184716452 22:46285072-46285094 GTGGCATTCGGGATGGGAGAAGG - Intronic
1185063945 22:48621326-48621348 ATGGAAGCAGGGATGGATGATGG - Intronic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
949681960 3:6524265-6524287 GTGGAGGTAGGGATGGAAGTAGG + Intergenic
949966146 3:9358159-9358181 CTGGAATTAGGTAGTAAAGATGG - Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950598311 3:14006223-14006245 CTAGGATTAGGGATGAAAGAGGG - Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
951031897 3:17892020-17892042 ATGAAATAAGGGATGGAGGATGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951526239 3:23655737-23655759 CTAGAAACAGGGATGGAAGAAGG - Intergenic
953452896 3:43018848-43018870 TTGGAATTAGGGCTGGAGCAGGG + Intronic
954383387 3:50231622-50231644 CTGGAATTAGGGATATGAGTGGG + Intronic
955242600 3:57192478-57192500 CTGACATTAGGAATGAAAGAGGG - Intergenic
955305088 3:57822599-57822621 CAGGATTGAGGGATGGGAGATGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956181312 3:66520396-66520418 CTGGAATTAAAGACGGAAGATGG - Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
957521386 3:81323054-81323076 CTGGAAATAGGGAAGGAATGAGG - Intergenic
957934750 3:86927763-86927785 CTGGAAATAGGGGTTGATGATGG - Intergenic
957955953 3:87187183-87187205 TTGGTGTTGGGGATGGAAGAGGG + Intergenic
958253593 3:91298892-91298914 CTGGAGTGAGTGATGGGAGAGGG - Intergenic
958899291 3:99866795-99866817 CTGTAATTAGAGATGGCATATGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
961340151 3:126212375-126212397 ATGGAAGGAGGGAAGGAAGAAGG + Intergenic
965333382 3:167405669-167405691 CTGAAATTAGTAATTGAAGAAGG + Intergenic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
965793368 3:172412210-172412232 CTGGAATTAGATAAGGTAGATGG + Intergenic
965839844 3:172892098-172892120 CTGGAATGAGGGATATCAGAAGG + Intronic
966185376 3:177222144-177222166 CTGAAATGAGTTATGGAAGAAGG + Intergenic
968771023 4:2507186-2507208 CTGGAAGGAAGGAAGGAAGAGGG + Intronic
969849267 4:9943563-9943585 CTGGAATTAGGGAAGGCCGATGG + Intronic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970903384 4:21186423-21186445 GTCGAAGTAGGGATGGAATAAGG + Intronic
970960835 4:21869525-21869547 CTGGAATTTGGGAAGAAATAGGG - Intronic
971603282 4:28623725-28623747 CAGGAATGAGAGATGGAAAAGGG - Intergenic
971670820 4:29554793-29554815 GTGGAATTTGGGTGGGAAGAAGG - Intergenic
971780110 4:31022654-31022676 CTGAAAGTAGGAATGGAGGAAGG - Intronic
973292578 4:48484245-48484267 TTGGAATTAGGCGTGGAGGAAGG + Intronic
973573798 4:52265999-52266021 CTGGAATCAGGAAGGGCAGAGGG - Intergenic
973581905 4:52352380-52352402 TTGGAATTTGGCATGGAAGTTGG - Intergenic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
974142535 4:57905452-57905474 AGGGAATTAGGGATGGAAGTAGG + Intergenic
975324403 4:73043125-73043147 TTGGACTTGAGGATGGAAGAAGG + Intergenic
976779058 4:88738378-88738400 CTGGGATGAGGGATGGGAGCAGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
978776194 4:112509441-112509463 ATGGAATCAGAGATGGAAGGGGG - Intergenic
978823813 4:112996255-112996277 CTGGGAATAGGGATGGGAGCAGG + Intronic
978833547 4:113118345-113118367 CTGGGATTAGGGATGCAATGGGG + Intronic
979222736 4:118247589-118247611 CTGGAACTAGGGATGACAGCAGG + Intronic
979516114 4:121612300-121612322 ATGTGATTAGGGTTGGAAGAAGG - Intergenic
981138393 4:141238682-141238704 TGGGAATTAGGGGTGGAAGCAGG + Intergenic
981348620 4:143702548-143702570 CTGGAAGTAGAGATGGATGTGGG + Intergenic
982280920 4:153683459-153683481 TGGGAAGTAGGGATGGAATAGGG + Intergenic
982989650 4:162255854-162255876 CTGGAATAAGGGAGGTAAGTTGG + Intergenic
983428566 4:167619440-167619462 CTGGACTTAGGGATGCCAGGTGG + Intergenic
983944772 4:173573296-173573318 ATGGAAGTAAGAATGGAAGAGGG - Intergenic
985866589 5:2519135-2519157 CTGGCATTAAGCATGGAAGAGGG + Intergenic
985963769 5:3324490-3324512 CTTGAATTTGGGATGGGAGGAGG + Intergenic
986092340 5:4522808-4522830 CCATAATTAGGGATGAAAGATGG + Intergenic
986417134 5:7540445-7540467 CGGAAATTAGAGATGGAAAAAGG - Intronic
987040569 5:14058191-14058213 CTGGAATTAGAGAGTGATGATGG - Intergenic
987220442 5:15785569-15785591 CTTTAATTGGGGATGGAGGAGGG - Intronic
988637205 5:32997447-32997469 CTGGAGTTAGGGCAGAAAGAAGG - Intergenic
989567708 5:42917248-42917270 TTGTAATAAGGGCTGGAAGAGGG + Intergenic
990471392 5:56119418-56119440 CAGGGCTTAGGGATGGGAGAGGG + Intronic
991518913 5:67472456-67472478 AGGGAAGGAGGGATGGAAGAAGG - Intergenic
992903739 5:81324684-81324706 ATGGAATTAGTGATGTAGGAGGG + Intergenic
992933051 5:81670814-81670836 CTAGAATTAAGGAAGGAATAGGG - Intronic
994741218 5:103621873-103621895 GTGGGATTAGGGGTGGAATAGGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
996779040 5:127163654-127163676 CTAAAATTGGGGATGGGAGAGGG + Intergenic
997530969 5:134581036-134581058 TTGGAGTTAGGGGTGGATGAAGG - Exonic
997632781 5:135382094-135382116 CTGGAATCAGGCAAGGAAAAAGG - Intronic
998878821 5:146626953-146626975 ATGGAAATGAGGATGGAAGAAGG + Intronic
999061490 5:148640304-148640326 CTGGAGCTAGGGATTGGAGAAGG - Intronic
1001155572 5:169269720-169269742 CAGGAATTAGGGAGGGAGAAGGG + Intronic
1002866991 6:1130431-1130453 GTGGAAGTAGGGGTGGAAGTAGG + Intergenic
1002879363 6:1237919-1237941 CTAGGATTAGGGATAGAAGGAGG + Intergenic
1003521126 6:6859443-6859465 CAGGAATTGAGGATGGAAGCAGG - Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1007623872 6:43231405-43231427 CTGGAGTTAGGGAAGTAAGAGGG - Intergenic
1007865244 6:44961912-44961934 CTGGAATAAGGAAAGGAAAATGG - Intronic
1008280637 6:49591859-49591881 CTGGAATTTTGGAAGAAAGATGG + Intergenic
1009730237 6:67592957-67592979 CTAGAATTAGAGCTTGAAGAAGG + Intergenic
1009868761 6:69430687-69430709 CTGAAATTTCGGATGGAAAAGGG + Intergenic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1009932777 6:70195705-70195727 CTGGAAGTGGGGGTGAAAGAGGG - Intronic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010359516 6:74976554-74976576 TTGGAATTAGGGATGGTAGCAGG - Intergenic
1011820581 6:91248503-91248525 CTAGAATGAGAGATGGATGAAGG - Intergenic
1013232646 6:108170991-108171013 CTGGAACCAGGGATGGCAGCTGG - Intronic
1013360585 6:109390586-109390608 CAGGAGTTAGGGATGGCAGAGGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014165834 6:118223643-118223665 TTGGCATTTGGGATGGGAGATGG + Intronic
1015222867 6:130825006-130825028 TTGGGATTAGAGATGGCAGAGGG - Intergenic
1015738418 6:136426530-136426552 CAGGAATTTGGAGTGGAAGAAGG + Intronic
1016206215 6:141471732-141471754 AAGGATTTAAGGATGGAAGAAGG - Intergenic
1016384814 6:143520217-143520239 ATGGAATCAGGGAAGGAAAATGG + Intergenic
1017117748 6:150995141-150995163 CTGGACTTAGGGATGGGGGAGGG + Intronic
1017707013 6:157132765-157132787 CTTCAATTAGGGAGGGGAGAAGG - Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1019324643 7:432152-432174 CTGGGTTCAGGGCTGGAAGATGG + Intergenic
1020447854 7:8287661-8287683 ATGGAAAGAGGGAAGGAAGAAGG - Intergenic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021518996 7:21519802-21519824 CTGGACATAGTAATGGAAGAAGG + Intergenic
1023294756 7:38702916-38702938 ATGGAATTAGGCATGGAATTAGG + Intergenic
1023978933 7:45054662-45054684 CTGGGATTAGTGAAAGAAGACGG - Intronic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1026421565 7:70242399-70242421 GGGGAAGTATGGATGGAAGAAGG - Intronic
1026744421 7:72999937-72999959 CTAGAATGAGGGATCGGAGAGGG - Intergenic
1027030526 7:74884602-74884624 CTAGAATGAGGGATCGGAGAGGG - Intergenic
1027099316 7:75365155-75365177 CTAGAATGAGGGATCGGAGAGGG + Intergenic
1029378566 7:100197678-100197700 CTAGAATGAGGGATCGGAGAGGG + Intronic
1029881421 7:103814972-103814994 AGTCAATTAGGGATGGAAGAAGG + Intronic
1030628825 7:111873173-111873195 CTGGACTCTGGGATGAAAGATGG - Intronic
1032644349 7:133805828-133805850 AAGGAAGAAGGGATGGAAGAAGG + Intronic
1032790201 7:135237121-135237143 ATGGTATTATAGATGGAAGAAGG + Intronic
1032790937 7:135242022-135242044 CAGGAAGTAAGGAGGGAAGAAGG + Intronic
1032948093 7:136874581-136874603 CTTGGATTTGGGAGGGAAGAGGG - Intronic
1033358905 7:140623978-140624000 GTGGAAATAGGGATGTGAGATGG - Intronic
1033485614 7:141786207-141786229 GTAGAATAGGGGATGGAAGATGG + Intronic
1034712523 7:153206414-153206436 CTGGACTTAAGGATTTAAGAGGG - Intergenic
1035276784 7:157752677-157752699 CTGCAATCAGGGCAGGAAGACGG - Intronic
1036017734 8:4804566-4804588 AGGGAATTAGGGAGGGAGGAAGG + Intronic
1036797898 8:11769449-11769471 GTGAAAGCAGGGATGGAAGAAGG - Intergenic
1037817034 8:22117806-22117828 CTGGGCTTAGGGCTGCAAGATGG + Intronic
1038483066 8:27914916-27914938 CTGGGATCAGGGAAGGGAGAAGG - Intronic
1038491964 8:27977771-27977793 CTGGAATTAGGTAAGGAGGCCGG - Intronic
1038879729 8:31595520-31595542 CAGTTATTAGGGATGGAAAAGGG - Intergenic
1038891235 8:31726769-31726791 CTGGAATGAGGCAAGGAGGAGGG + Intronic
1039121421 8:34152064-34152086 TTTGAGTTAGGGTTGGAAGATGG - Intergenic
1039156845 8:34569687-34569709 CAGGAGTTAGGGATGGCAGGGGG + Intergenic
1039609188 8:38905531-38905553 CTTGATTTAGGGAAGGAGGAGGG - Intronic
1040967797 8:53101701-53101723 CTGGACTTAGGGATCCAACACGG - Intergenic
1041021799 8:53645501-53645523 CTGGAATTGGAGATGGTAGTGGG - Intergenic
1041524068 8:58786430-58786452 CTGGAAATAGGGAAGGTAGAGGG - Intergenic
1041615896 8:59906757-59906779 CTGGAAATAGGCACTGAAGAGGG + Intergenic
1041800537 8:61793007-61793029 CTGGAATTTGAGATGGAGAAAGG + Intergenic
1042031737 8:64483691-64483713 CAGGAATTAGTGATGGAGAAGGG - Intergenic
1042079996 8:65041077-65041099 CTGGTATTAGGGATAGAAGAGGG + Intergenic
1042566034 8:70113112-70113134 CCTGAATTTGGGATGGAAGCAGG - Exonic
1043000633 8:74755779-74755801 ATGGAACTAGGGATAGAAGTGGG + Intronic
1043527863 8:81115655-81115677 TGGAATTTAGGGATGGAAGAAGG + Intergenic
1044944603 8:97378840-97378862 CAGGAATGAGGGATGAGAGAGGG - Intergenic
1045000319 8:97872646-97872668 CTGGCTTTGAGGATGGAAGAAGG - Intronic
1045356698 8:101395898-101395920 ATGAAAATAGGGATGGGAGAAGG - Intergenic
1045605051 8:103763532-103763554 ACGGAATAAGGGAGGGAAGAAGG + Intronic
1045870105 8:106916882-106916904 ATGGAAGAAGGGAGGGAAGAAGG - Intergenic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048959361 8:139563138-139563160 CTGGTGTTAGGGATGGAGGGAGG - Intergenic
1049416138 8:142496225-142496247 CTGGATGTAGAGATGGTAGATGG + Intronic
1049960063 9:729752-729774 GTGGAAGTAGTAATGGAAGAGGG + Intronic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1052026640 9:23580961-23580983 CTGGAATGAGGGGTGGACAAAGG - Intergenic
1054915441 9:70491414-70491436 TTGGTCTTAGGCATGGAAGAAGG - Intergenic
1055075827 9:72214047-72214069 ATGGAGTTAGAGATGGAAAAAGG + Intronic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1055323088 9:75100993-75101015 CTCAAATTAGGGATGGAGGAAGG - Intronic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1055641114 9:78319732-78319754 GTGGAATTAGGCAGAGAAGAGGG + Intronic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056750858 9:89350130-89350152 CTTGTATTAATGATGGAAGAGGG + Intronic
1057068893 9:92078965-92078987 ATGGAAACAAGGATGGAAGATGG + Intronic
1057690610 9:97280807-97280829 CTGGACTAAGAGTTGGAAGAGGG + Intergenic
1058547867 9:106080432-106080454 CTGGGATGAAAGATGGAAGAGGG + Intergenic
1059111586 9:111562950-111562972 ATGTAATTAGTGATGGAGGATGG - Exonic
1059360715 9:113739941-113739963 CTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1061887727 9:133601099-133601121 GTAGAGTGAGGGATGGAAGAAGG - Intergenic
1061911561 9:133727880-133727902 GAGGAATTAGGGATGGAGGATGG + Intronic
1062276226 9:135732816-135732838 CAGGAAGGAGGGAAGGAAGAAGG - Intronic
1062382694 9:136295065-136295087 CAGGAGTTAGGCCTGGAAGAGGG + Intronic
1062585200 9:137246127-137246149 TTGGAATGAGGGGTGGGAGAGGG - Intronic
1185678653 X:1869908-1869930 CTAGTATCAGGGATGCAAGAGGG + Intergenic
1186493357 X:9992537-9992559 CTGAAATCACGGATGGAAGCCGG - Intergenic
1187956551 X:24524327-24524349 CTGGAAGTAGGTATGGAAGCTGG + Intronic
1187956554 X:24524346-24524368 CTGGAAGTAGGTATGGAAACTGG + Intronic
1188447287 X:30268580-30268602 CTGGAATTGGTAATGGAATATGG - Intergenic
1188577408 X:31668756-31668778 GTGGATTTAGGGGTGGAAAATGG - Intronic
1190201013 X:48360843-48360865 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190210807 X:48445857-48445879 CAGGGATTAGGGATGGTGGATGG + Intergenic
1190424188 X:50316619-50316641 CAGGAGTTAGGGGTGGAAGGTGG - Intronic
1190437790 X:50443863-50443885 CAGGGATTAGGGATGGGAGGGGG - Intronic
1190607035 X:52154205-52154227 CTGGAACTATGGATAGAAGCTGG + Intergenic
1190667839 X:52711293-52711315 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190671578 X:52747111-52747133 CAGGGATTAGGGATGGCGGATGG + Intergenic
1190963987 X:55280333-55280355 CTGGAACTAGGGAGGAAAGTGGG + Intronic
1192577691 X:72255862-72255884 CCTGAATTAGGGACTGAAGAAGG + Intronic
1193336813 X:80299344-80299366 ATGGGATTGGGGATGGAAGGTGG - Intergenic
1194697838 X:97077285-97077307 CTGGAATTGGGGGTAGAAAAAGG - Intronic
1195142012 X:101970934-101970956 CTAGAATTAGATATTGAAGATGG + Intergenic
1195301378 X:103533503-103533525 CTGGAAGTCTGGATGGAAAATGG - Intergenic
1195994335 X:110716643-110716665 GAGAAATTAGGGATGGAAGTGGG + Intronic
1199176901 X:144799433-144799455 CTGGAACTAGGGGTAGCAGAAGG + Intergenic
1199441573 X:147874542-147874564 ATGGAAGTAGGGAGAGAAGAAGG + Intergenic
1199495585 X:148448759-148448781 ATGCAATTAAGGAGGGAAGAGGG - Intergenic
1199670208 X:150139682-150139704 ATGACATTAGGAATGGAAGAGGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1201013159 Y:9570507-9570529 ATGTATTTAGGAATGGAAGAAGG - Intergenic