ID: 1100481488

View in Genome Browser
Species Human (GRCh38)
Location 12:94983860-94983882
Sequence GAGTGCAAAAGTCATTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100481485_1100481488 25 Left 1100481485 12:94983812-94983834 CCTTTATTCTTCACAGCAACCAC 0: 1
1: 0
2: 2
3: 30
4: 294
Right 1100481488 12:94983860-94983882 GAGTGCAAAAGTCATTAAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1100481486_1100481488 6 Left 1100481486 12:94983831-94983853 CCACAGAGATGCTTTAAAAATGT 0: 1
1: 1
2: 7
3: 60
4: 509
Right 1100481488 12:94983860-94983882 GAGTGCAAAAGTCATTAAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1100481484_1100481488 29 Left 1100481484 12:94983808-94983830 CCTTCCTTTATTCTTCACAGCAA 0: 1
1: 0
2: 4
3: 45
4: 414
Right 1100481488 12:94983860-94983882 GAGTGCAAAAGTCATTAAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100481488 Original CRISPR GAGTGCAAAAGTCATTAAGT GGG Intronic
903150894 1:21407829-21407851 GAGTGCCAAAATCATTCAATGGG - Intergenic
903166084 1:21521466-21521488 GAACTCAAAAGTCATTAAATGGG - Intronic
903633200 1:24793033-24793055 CAGTGTTAAAATCATTAAGTTGG - Intronic
904989238 1:34578228-34578250 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
907618793 1:55953897-55953919 GTGTGCAAAAGCTATTAAATGGG + Intergenic
908086333 1:60638509-60638531 TAGTGCCAAAGTTATTTAGTGGG + Intergenic
909893993 1:81042969-81042991 TGGTGCAAAAGTAATTAGGTTGG + Intergenic
914354943 1:146876754-146876776 GACTGAAACAGTCATTAAATAGG - Intergenic
915370356 1:155344766-155344788 GCTTGCCTAAGTCATTAAGTGGG - Intronic
916628158 1:166582265-166582287 AAGTGCAATGGTCATGAAGTGGG - Intergenic
916702279 1:167309539-167309561 CAGTCCAAAAGTCATTAGATGGG - Intronic
917608650 1:176663407-176663429 AAGTTCAAAAGTCATAATGTAGG - Intronic
919135979 1:193508182-193508204 CAGTGCTAAAGTCATTAAATGGG - Intergenic
919295382 1:195692524-195692546 GAGTGCCAAGATCATTGAGTGGG + Intergenic
921253226 1:213316856-213316878 GAATGCAAAAGTCCTGCAGTAGG + Intergenic
921593429 1:217029410-217029432 GTGTTCAAAATTCACTAAGTAGG + Intronic
922284191 1:224154368-224154390 AAGTCAAAAAATCATTAAGTTGG + Intronic
1067375728 10:45726718-45726740 GAGTGCAAAGGACTTTAAGCAGG + Intergenic
1067883438 10:50067407-50067429 GAGTGCAAAGGACTTTAAGCAGG + Intergenic
1072197142 10:93125905-93125927 GAGTGGAAAAGTCAATGAATAGG + Intergenic
1078915495 11:15774941-15774963 CAGTGGAAAAGTCATGAGGTGGG - Intergenic
1079646103 11:22865190-22865212 CAGTTCAAAAGTCATCAAGCAGG - Intergenic
1079698106 11:23509292-23509314 GAGTGTGAAAGTGATTAAGGTGG - Intergenic
1080189908 11:29532044-29532066 GAGTGAAAATGTCATTACTTAGG - Intergenic
1080362068 11:31527033-31527055 CAGTGAGAAAGTCATTAAGGTGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085164063 11:74379872-74379894 GAGTGCAAATGTCATGATCTCGG - Intronic
1085414078 11:76308730-76308752 GGGTGCTAAAGCCATTAAATGGG - Intergenic
1089057966 11:115602519-115602541 AAGTGCAAAAGCCATAAAGAAGG + Intergenic
1090573002 11:128068258-128068280 GTGTGCAGAAGTCAATAATTGGG - Intergenic
1091836442 12:3589438-3589460 GAGTGGGAAAGACATTAATTAGG - Intronic
1093740970 12:22687685-22687707 GAGCACAAAACTCATCAAGTAGG + Exonic
1093954655 12:25202275-25202297 CAGTCCAAAAGTCATTACGTGGG + Intronic
1097175672 12:57141507-57141529 GAGTGGAAAAGTCCTTACCTCGG - Exonic
1099993931 12:89756197-89756219 CAGTGCAAAAATCCTTAGGTAGG + Intergenic
1100481488 12:94983860-94983882 GAGTGCAAAAGTCATTAAGTGGG + Intronic
1101330079 12:103750594-103750616 GAGTGTAAAAGTCACTATGTCGG + Exonic
1102761123 12:115386159-115386181 TAGTGCAAATGTCATGAGGTTGG - Intergenic
1104407466 12:128530086-128530108 GAGTGAAAAAGGCAGAAAGTGGG + Intronic
1104663409 12:130628829-130628851 GAGGGCACAAGTCAATAACTGGG + Intronic
1105048159 12:133024265-133024287 GAGTCTAAAAGTCATCAAGGAGG + Exonic
1106214617 13:27684962-27684984 AAGTGCAAAAGCAATTTAGTGGG + Intergenic
1109122314 13:58473253-58473275 TAGTGCATAAGTCATTAAAATGG + Intergenic
1110002811 13:70227510-70227532 GAGTGCAAAAGTAACTTAGATGG + Intergenic
1110708820 13:78627185-78627207 AAGTACTAAAGTCATTAAGAAGG + Intronic
1112757837 13:102658967-102658989 GAGTGCTAAGCTCCTTAAGTGGG + Intronic
1115061095 14:29190998-29191020 AAGTCCAAAAGCCATTAGGTAGG - Intergenic
1115100428 14:29691611-29691633 TGGTGCAAAAGTTATTAGGTTGG + Intronic
1116342938 14:43749704-43749726 GGGTTCAAAAATCATGAAGTGGG - Intergenic
1118430300 14:65712493-65712515 GAGTGCAAATGGCATGATGTCGG + Intronic
1124437980 15:29666668-29666690 AAGTGCAAAAGTCCTGAGGTGGG - Intergenic
1125357455 15:38831330-38831352 CAGTGCTAAAGCCATTAGGTGGG - Intergenic
1126570770 15:50147888-50147910 GAGTGCCAAAATCATTCAGTGGG + Intronic
1126865458 15:52932373-52932395 GAGTGCAAGATACATTAAGGTGG - Intergenic
1128930694 15:71702630-71702652 GAGGACAAAAGTCATCAACTGGG + Intronic
1130407887 15:83618385-83618407 ACATACAAAAGTCATTAAGTTGG - Exonic
1132199178 15:99936943-99936965 GAGTGGCAAGATCATTAAGTAGG - Intergenic
1132404212 15:101532657-101532679 GAGTGAAATAGTCCTTATGTAGG - Intergenic
1132768884 16:1549854-1549876 GAGTGGAAAAGTAATCAAGGTGG - Intronic
1134150075 16:11798113-11798135 GAGTGCAAAAGCCCTGAAGCTGG + Intergenic
1139979077 16:70838775-70838797 GACTGAAACAGTCATTAAATAGG + Intronic
1145419295 17:22756257-22756279 GAATGCAAACGTCATGAAGAAGG - Intergenic
1145434483 17:23015442-23015464 GAATGCAAACGTCATGAAGAAGG - Intergenic
1145442295 17:23123709-23123731 GAATGCAAACGTCATGAAGAAGG - Intergenic
1153271038 18:3321616-3321638 GAGTGCAATAGTCAGTCACTTGG + Intergenic
1154982188 18:21511978-21512000 GGGTGCCAAAGCCATTCAGTGGG - Intronic
1157010454 18:43642234-43642256 GAGTGTAAGAGGGATTAAGTTGG - Intergenic
1159093982 18:63881259-63881281 GAGTTCAAAAAATATTAAGTCGG + Intronic
1159414116 18:68121875-68121897 GAGTGTGAAAGACATTAATTAGG + Intergenic
1160056893 18:75491752-75491774 AAGCACAAAAGTCATTAAGTAGG + Intergenic
1166886089 19:45961864-45961886 GAGTGCAAAGGCCCTGAAGTGGG + Intronic
1167755908 19:51413639-51413661 GGGTGCAAAAGTCAGAAAGTGGG + Intronic
925790444 2:7480295-7480317 GAAGTCAAAAGTCAATAAGTGGG + Intergenic
931676960 2:64706771-64706793 GAAAGCAAAAGTCAATAAATGGG + Intronic
932297700 2:70640959-70640981 GAGGGCAAAACTCAGGAAGTGGG - Intronic
933825368 2:86155171-86155193 GAATGCAAAGGTTATTAAGAAGG - Intronic
935553975 2:104486622-104486644 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
939185424 2:138855072-138855094 GAGTGTAAATGACATTAACTAGG - Intergenic
939299406 2:140315977-140315999 GAGTCAAAATGTTATTAAGTAGG - Intronic
940111180 2:150155879-150155901 GTTTGAAAAAGTCATTCAGTTGG - Intergenic
941235858 2:162972488-162972510 GAGGGCAAAACTCATGAAATTGG - Intergenic
941406544 2:165096191-165096213 GAGTGGAAAAGTTGTTCAGTGGG - Intronic
943984363 2:194601064-194601086 GAGTGCTAAAGCCATTCAATGGG - Intergenic
944893152 2:204138006-204138028 GAGTGCAAATGTGATTGTGTGGG - Intergenic
945157246 2:206852360-206852382 GAGTGTGAAATTCATTTAGTGGG - Intergenic
945530189 2:210944069-210944091 GAGTGCAAATGTCTTGAGGTTGG + Intergenic
946631618 2:221675342-221675364 GAGTGCAAATGCCTTCAAGTGGG - Intergenic
948365360 2:237451175-237451197 AAGTGAAAAAGTGATAAAGTGGG - Intergenic
1169693936 20:8365731-8365753 GTGTGGTATAGTCATTAAGTTGG - Intronic
1169819789 20:9697460-9697482 GAGGGCCAAAGTCTTTAACTGGG - Intronic
1170441910 20:16387696-16387718 GAGTGCGAAAGGCAAAAAGTGGG + Intronic
1175309575 20:58002391-58002413 GTGGGCAAAAGTCATGAAGGTGG - Intergenic
1176924893 21:14736615-14736637 GAGTGACAAAGTCAGAAAGTTGG - Intergenic
1177588434 21:23129231-23129253 AATTTCAAAAGTCATTAAATTGG + Intergenic
1178043002 21:28662296-28662318 GAGAGCAAAAGTCTATCAGTGGG - Intergenic
1179028926 21:37703227-37703249 TAGTCCAAAAGTCTTTGAGTAGG + Intronic
1179475135 21:41638245-41638267 AAGTGCAAAAGTCCTAAAGCAGG + Intergenic
950951457 3:17004282-17004304 GACTTAAAAAGTCATGAAGTGGG - Intronic
951655735 3:25006008-25006030 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
954888446 3:53899720-53899742 GAGGGCAAAAATCATTGATTTGG - Intergenic
955603950 3:60678915-60678937 GAGTACTAAAGTCCTTAAGATGG - Intronic
955605892 3:60703088-60703110 GAGGGCAACAGTCATTGGGTAGG - Intronic
955906751 3:63815390-63815412 GTGTTGAAAAGTCATTAGGTAGG - Intergenic
956444114 3:69308786-69308808 CAGTGCAAAAGTCCTGAGGTGGG - Intronic
956480939 3:69673515-69673537 GAGTGAAAAAGGCATTGACTTGG + Intergenic
957386311 3:79501313-79501335 CAGTGAAAAAGTCATTGAGGTGG - Intronic
957882656 3:86240512-86240534 GAGTGCAGAGGTCATGAAGAAGG + Intergenic
958255659 3:91321817-91321839 AAGTGCAAAGGTCCTGAAGTGGG - Intergenic
959004067 3:100999337-100999359 GGGTGCAAAATTAATTCAGTGGG - Intergenic
960572377 3:119197950-119197972 GAGTGCAAAGGCCCTTAAGTGGG + Intronic
961417988 3:126775511-126775533 GATTTCAAAAGTCAGTAACTGGG + Intronic
963426679 3:145137750-145137772 GAGTGCAACACTCATTATGAAGG + Intergenic
970813221 4:20121600-20121622 GAATTCAAAAGTCATGATGTAGG - Intergenic
971591709 4:28477238-28477260 GAGTTCAAAAATCGTTAAATGGG - Intergenic
973132912 4:46670887-46670909 TAGTGCAAAAGTCATAGGGTAGG + Intergenic
975636465 4:76454424-76454446 GAGTGCCAAGATCATTCAGTAGG - Intronic
980319542 4:131251690-131251712 AAGTCCAAAAGTCATCAAGTTGG + Intergenic
987515641 5:18903926-18903948 GACTGAGAAAGTCATAAAGTAGG - Intergenic
987791917 5:22579357-22579379 GGGCACAAAAGTCATTAAATCGG - Intronic
989096745 5:37788882-37788904 CAGTGCAAAAGTCTTTAAAAAGG - Intergenic
990275541 5:54192081-54192103 AAGTGCAAAGGTCCTGAAGTTGG - Intronic
994435332 5:99722865-99722887 GAATGCCAAACTCATTAAGGAGG - Intergenic
995600883 5:113794550-113794572 GAGTTCAAAAGGCCTGAAGTGGG + Intergenic
997274384 5:132572239-132572261 CAGTCCAAAAGCCATTAGGTAGG + Intronic
998815481 5:146009745-146009767 TTGTGAAAAACTCATTAAGTAGG - Intronic
1001548312 5:172584359-172584381 GAGTGGAAATGTCATTCAGGGGG - Intergenic
1002109415 5:176898213-176898235 GAGTGCAGAGGTGATCAAGTTGG - Intronic
1002305994 5:178283367-178283389 AAGTGCACAGGTCATGAAGTTGG - Intronic
1003597268 6:7485388-7485410 GAGTGCCAAGATCATTCAGTGGG - Intergenic
1005886034 6:30098427-30098449 GAGTGGAGAAGTCATTAGGAGGG - Intergenic
1006454480 6:34123960-34123982 GTGTGCAAAAGTCATCAGGGTGG + Intronic
1008065242 6:47040628-47040650 GGGTGCACAAGTCAGAAAGTGGG - Intronic
1008505535 6:52226244-52226266 GAGGGCAAAAGCAATTAAGTTGG - Intergenic
1008999689 6:57699349-57699371 AAGTGCAAAGGTCCTGAAGTGGG + Intergenic
1009188172 6:60598771-60598793 AAGTGCAAAGGTCCTGAAGTGGG + Intergenic
1009255540 6:61389733-61389755 GAATGCAAACATCACTAAGTAGG - Intergenic
1009515613 6:64613191-64613213 TTGTTCAAAAGTCATTAATTTGG - Intronic
1010643694 6:78361614-78361636 CAGTGGAATAGACATTAAGTTGG - Intergenic
1012377025 6:98574411-98574433 TAGTCCAAAAGTTATTATGTGGG - Intergenic
1013685959 6:112583297-112583319 AAGAGCAAAAGTGATTGAGTGGG - Intergenic
1014672515 6:124323559-124323581 AGGTACAAAAGTGATTAAGTGGG - Intronic
1014781844 6:125573789-125573811 AGGTGCAAAAGTCATTAACGGGG - Intergenic
1016952831 6:149597662-149597684 GAGTGAAAAAGATATTAAGTTGG + Intronic
1018218608 6:161555712-161555734 GAGTGCAAAAGTCTGTAATAAGG - Intronic
1018526764 6:164719838-164719860 GAGTGAAAAATTGATAAAGTGGG + Intergenic
1021806866 7:24366156-24366178 GAGTGCAAAAGCTCTAAAGTGGG - Intergenic
1023661977 7:42479305-42479327 GAGTGCAGAAGTAAATGAGTGGG + Intergenic
1024196710 7:47066356-47066378 GAGGTAAAAAGTCATTATGTTGG - Intergenic
1028492407 7:91426739-91426761 ATGAGCAAATGTCATTAAGTCGG - Intergenic
1030511430 7:110487352-110487374 AAGTGCAAATGGCATTAAGTAGG + Intergenic
1030556229 7:111027547-111027569 GACGGCTAAAGTCATTTAGTGGG + Intronic
1034736056 7:153430567-153430589 GAGTGCAAAAGTCCTGTGGTAGG + Intergenic
1041230250 8:55743256-55743278 GAGTGCTACAGACATTTAGTGGG - Intronic
1043183488 8:77115303-77115325 GAGAGCAAAGGTCATGAAGCTGG - Intergenic
1045018578 8:98021059-98021081 GACTGCAAAAGACATTATGAAGG + Intronic
1045441814 8:102221321-102221343 TAGTGCAAAAGGCACTAAGAAGG + Intronic
1045713724 8:105016972-105016994 GAGTCTAAGAGTCATGAAGTTGG + Intronic
1045776297 8:105807197-105807219 GTGTGCAAAATTAATTAAGCTGG + Intergenic
1046229215 8:111331548-111331570 GGCTGCAAAAGTTATTTAGTTGG + Intergenic
1046291761 8:112171669-112171691 GAGTGCACATCTCATTCAGTGGG - Intergenic
1046851119 8:118973983-118974005 CAGTGCAAAAGTCCTGAAATGGG - Intergenic
1048402756 8:134087240-134087262 GGGTGCTACAGGCATTAAGTGGG + Intergenic
1050934394 9:11376642-11376664 GAGTTCAAAAGTGAGTAGGTTGG - Intergenic
1052014111 9:23444911-23444933 GAGTGAAAATGTCCTTAAGGAGG + Intergenic
1052472131 9:28912839-28912861 GAATCCAAAAGTCAGGAAGTAGG - Intergenic
1053485537 9:38452338-38452360 TTGTGCAAAAGTAATTTAGTAGG - Intergenic
1054983221 9:71231485-71231507 GAGGTCAAAAGTCTTCAAGTAGG - Intronic
1058050773 9:100404081-100404103 GTGTTTAAAAGTCATAAAGTAGG - Intergenic
1058554881 9:106156530-106156552 GAATGCAAAAGTATTTAACTTGG - Intergenic
1058578513 9:106429649-106429671 GAGTTCAAAAATAATTATGTAGG + Intergenic
1059052511 9:110941782-110941804 GATTGCAATAGCCAGTAAGTTGG + Exonic
1061699802 9:132407300-132407322 GAGTGCAAAAGTCCTGAACTTGG + Intergenic
1187128836 X:16481352-16481374 GAGTCCAAAATTCCCTAAGTAGG + Intergenic
1188737571 X:33737816-33737838 AAGTGCAAAAGTTCTGAAGTCGG - Intergenic
1189200405 X:39190684-39190706 CAGTGCAAAGGCCATGAAGTAGG - Intergenic
1190088627 X:47418230-47418252 GAATGCAATAGTCATCAAGTGGG + Intergenic
1190994283 X:55590897-55590919 GAGTGTCAAGATCATTAAGTGGG + Intergenic
1192720067 X:73685779-73685801 AAGTGCAATAGTCATTCTGTAGG - Intronic
1193875041 X:86852058-86852080 GGGTGCCAAAATCATTCAGTGGG - Intergenic
1195657023 X:107341503-107341525 GAGAGCAAAAGTCCTTAAGAAGG - Intergenic
1197339237 X:125245378-125245400 GAGTGCCAATTTCATTTAGTGGG - Intergenic
1198505163 X:137294202-137294224 AAGTGCAAAAGTCCTGAGGTAGG - Intergenic