ID: 1100481549

View in Genome Browser
Species Human (GRCh38)
Location 12:94984219-94984241
Sequence GTGGACAAGCTAGGAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100481549_1100481553 -10 Left 1100481549 12:94984219-94984241 CCCATGTTTCCTAGCTTGTCCAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1100481553 12:94984232-94984254 GCTTGTCCACTGAGAAGGCCTGG 0: 1
1: 1
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100481549 Original CRISPR GTGGACAAGCTAGGAAACAT GGG (reversed) Intronic
904169636 1:28582399-28582421 GTGGACAAATAAGGAAACTTAGG + Intergenic
906248096 1:44291121-44291143 GGGGTCAAGCTAGGAAATAGGGG + Intronic
911041335 1:93593279-93593301 AAGGACAAGCTGGGAAACTTGGG - Intronic
912041428 1:105396459-105396481 GTGGGCAAGCAAGCAAGCATGGG + Intergenic
912296078 1:108472276-108472298 GGGGACAAGGTGGGAGACATAGG - Intergenic
916282920 1:163072394-163072416 GTGCAAAAGATATGAAACATCGG + Exonic
920200877 1:204259102-204259124 TTGGGCAAGCCAGGAAGCATGGG + Intronic
922534299 1:226368436-226368458 GTGCACATGCCAGGACACATGGG + Intronic
1064749626 10:18514187-18514209 GTGGACAGGAGAGGAAAAATAGG - Intronic
1065277022 10:24095790-24095812 TTGGACAATCTAGTACACATTGG - Intronic
1073673360 10:105617254-105617276 GTGGACAAGAAAGGCAGCATAGG + Intergenic
1075910905 10:126125074-126125096 GTGAATAAGCTAGAAACCATTGG - Intronic
1076036589 10:127203491-127203513 GATAACAAGCTATGAAACATTGG + Intronic
1076125775 10:127972576-127972598 GTGGACGAGCTTGGAAATAGAGG - Intronic
1076227402 10:128790884-128790906 GGGGTCAAGCTAGGCAACTTGGG + Intergenic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1086544884 11:87956565-87956587 GTGGACAAGGTTGGACACGTAGG - Intergenic
1090924678 11:131239118-131239140 GTGGACAAGATAGGACACAGAGG - Intergenic
1098410160 12:70173052-70173074 GTTAACATGCTATGAAACATAGG + Intergenic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1101407930 12:104445337-104445359 GGGGACAAGCCAGGGAACACTGG + Intergenic
1101948873 12:109159068-109159090 GTGGGCAAACTAGGACCCATGGG - Intronic
1103631976 12:122268733-122268755 GAGGCCAACCTAGGCAACATAGG - Intergenic
1105628574 13:22138092-22138114 GTGAACAACCTAGGAAAAATTGG + Intergenic
1109314445 13:60733858-60733880 CTGGCCAAGGTAGAAAACATAGG - Intergenic
1109666879 13:65551770-65551792 TTGTACAAGCCAGAAAACATGGG - Intergenic
1113968353 13:114167730-114167752 GTAGACAAGATAGAAAACTTAGG - Intergenic
1115906766 14:38209906-38209928 GTGGCCAAGGTAGTAAACCTGGG + Exonic
1116511182 14:45748724-45748746 GTGGTCAAGCTAAGAATCAAGGG + Intergenic
1121015252 14:90545169-90545191 GTGGACCAGGTGGGAAGCATGGG - Intronic
1121729490 14:96176381-96176403 GTGGATAAGCAAGGAAGGATGGG + Intergenic
1123459343 15:20455203-20455225 GTGGACAAGCCAGGAACTATGGG - Intergenic
1123658718 15:22545215-22545237 GTGGACAAGCCAGGAACTATGGG + Intergenic
1124265575 15:28231027-28231049 GTGGACAAGCCAGGAACTATGGG - Intronic
1124312583 15:28639711-28639733 GTGGACAAGCCAGGAACTATGGG + Intergenic
1125223980 15:37373582-37373604 GTGGTCAAGACTGGAAACATTGG - Intergenic
1125275117 15:37980509-37980531 GTGGACAAGTTGGGATTCATCGG - Intergenic
1125595247 15:40881293-40881315 GAGAACAACCTGGGAAACATAGG - Intergenic
1127332999 15:57956792-57956814 GTGCAGAAGCCAGGAAACAAAGG - Intronic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1136703756 16:32168401-32168423 GTGGACAAGCCAGGAACTGTGGG - Intergenic
1141711987 16:85705067-85705089 GTGGACAGGCTGGGAATCCTGGG + Intronic
1203066300 16_KI270728v1_random:1021327-1021349 GTGGACAAGCCAGGAACTGTGGG + Intergenic
1142500541 17:330399-330421 ATGGACAAGCAAGGAAAGACAGG + Intronic
1147952059 17:44112804-44112826 GTGGACCAGCAAAGAAACAGGGG + Intronic
1151459004 17:74243703-74243725 GTTGAGCAGCTAAGAAACATGGG + Intronic
1155166939 18:23239365-23239387 GTGGCCAGAATAGGAAACATAGG - Intronic
1158324412 18:56298563-56298585 GTGGACATGATGGGAAACACAGG + Intergenic
1167420503 19:49399861-49399883 GGGCACAAGGTAGGACACATAGG + Intronic
925491761 2:4402877-4402899 GTGGACCAGCTTGCAAACCTAGG + Intergenic
926256538 2:11206208-11206230 GTGGCTAAGATAGAAAACATGGG + Intronic
926368455 2:12155628-12155650 TTGGACAAAATGGGAAACATAGG - Intergenic
927356067 2:22174437-22174459 ATGGACTAGCTATGGAACATTGG - Intergenic
928423719 2:31160663-31160685 GTTGATAACATAGGAAACATGGG - Intergenic
931485199 2:62683721-62683743 GTGGAAAAACTAGGAAAGAAGGG + Intronic
932212488 2:69944283-69944305 GTGAACAAGTCAGGAAACTTCGG - Intergenic
933277094 2:80295394-80295416 GTGGACATGCTGGAAAACAGAGG - Intronic
936389578 2:112058937-112058959 GTGGACAATGTAGGAAAAGTTGG + Intronic
936696986 2:114962518-114962540 TTGAACAAGCTTTGAAACATGGG - Intronic
937389808 2:121475329-121475351 TCTGAAAAGCTAGGAAACATAGG - Intronic
941953948 2:171185246-171185268 GTTAAGATGCTAGGAAACATGGG - Intronic
943088374 2:183343882-183343904 GTGAACATGCAAGGAAACAATGG + Intergenic
944190020 2:196992694-196992716 GGGTACATGCTAGGATACATGGG + Intronic
944782485 2:203033782-203033804 GTGGAAATGATAGGAAACAGTGG - Intronic
945636278 2:212355588-212355610 ATGGAGAAGCTGGGAAAAATAGG - Intronic
946144987 2:217723957-217723979 GGGGACAAGCTATGTAATATCGG - Intronic
946678697 2:222190361-222190383 ATGGAGAAGCAAGGAAAGATGGG - Intergenic
948514207 2:238493377-238493399 GTGGACCAGCTAGGAACCTTAGG - Intergenic
1173569341 20:44066629-44066651 GTGGACACCCTTGGACACATGGG + Intronic
1173884758 20:46447242-46447264 GCAGACCAGCTAGGAAACTTGGG - Intergenic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1175597381 20:60246237-60246259 GTGGACATGCTTGGATACAGAGG + Intergenic
1177719814 21:24891577-24891599 TTGGAAAAGCTAGGGAACAGAGG + Intergenic
1178049942 21:28736298-28736320 GTGGAGCAGCTAGGAAATAGAGG - Intergenic
1178487287 21:33027061-33027083 GGGGACAAGCTAGGAGGCAGTGG + Exonic
1183362669 22:37390766-37390788 GTTGACAAGCAAGGAAACCGAGG - Intronic
951350578 3:21602344-21602366 GTGGACAATCTAGCACATATTGG + Intronic
954380831 3:50218220-50218242 GGTGACAAGCTGGGTAACATTGG - Intronic
954806283 3:53222755-53222777 GAGGACCAGCGAGGACACATGGG + Intergenic
957566852 3:81895125-81895147 GTGTACAGGCTTGGAAACTTTGG - Intergenic
958772662 3:98444331-98444353 GCAGACAAACTAGGAAAGATGGG - Intergenic
958856208 3:99389190-99389212 GAGGAGAGGTTAGGAAACATTGG + Intergenic
961843404 3:129737885-129737907 GTGCACAGGCTAGAAACCATTGG + Intronic
965384210 3:168026501-168026523 GGGAACATGCTGGGAAACATTGG - Intronic
965692598 3:171373385-171373407 GTGGACAAGGGTGGAAACTTAGG - Intronic
966379750 3:179332231-179332253 GTGGAGAAACTGGGATACATGGG + Intronic
968716981 4:2167450-2167472 GTGGACCAGCTAGGTACCACAGG + Intronic
970186699 4:13462616-13462638 CTGGAGAAGCTAGGTAACTTGGG - Intronic
971103241 4:23493446-23493468 GTGAACAATCTTGGAGACATAGG - Intergenic
971827933 4:31651676-31651698 GTAGACAAGTAAGGAAACAAAGG + Intergenic
973656005 4:53048534-53048556 GAGAACAGCCTAGGAAACATAGG + Intronic
973936448 4:55851469-55851491 GTGGACAAGCTGGCAAAGAAAGG + Intergenic
975647302 4:76557942-76557964 GTAGACAAGCTCAGAACCATGGG + Intronic
984683040 4:182633129-182633151 GAGACCAATCTAGGAAACATAGG - Intronic
987343573 5:16959260-16959282 GTGGCCAGCCTAGGCAACATAGG - Intergenic
988804178 5:34724950-34724972 GTGCACAAGCTTGGTAACCTAGG - Intronic
991010821 5:61881487-61881509 GGGGATAAGCTAGGAATCAGAGG - Intergenic
991137723 5:63202462-63202484 TTGGACAAGCTAGTAAGCATTGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994661264 5:102656976-102656998 GTGGAGAAGCTATGAAAGAGTGG + Intergenic
994844415 5:104968561-104968583 GTGGACAAGATATGAAAGTTAGG + Intergenic
996334060 5:122364028-122364050 ATGGACAGTCTGGGAAACATAGG - Intronic
998788335 5:145737474-145737496 GTGAAGAAGCTAGGAAACTTGGG + Intronic
999564637 5:152843897-152843919 TTGGACAAGCAATGAAACCTCGG - Intergenic
1000146774 5:158461167-158461189 GTGGACAAGCCAGGCAGAATGGG + Intergenic
1000858533 5:166429724-166429746 GTGGAAAAGCCAGAAAACAAGGG - Intergenic
1002965023 6:1956363-1956385 GTTGACAATCTAGGACTCATGGG - Intronic
1005059165 6:21760304-21760326 GTGGACTAGATAGGAAACTGTGG + Intergenic
1005869888 6:29967017-29967039 GAGGAAAAGCTAGGCAAGATAGG + Intergenic
1007719608 6:43877285-43877307 GTGGCCAAGCTAGGACAGCTTGG - Intergenic
1012868039 6:104641415-104641437 GGAGACCAGCTAGGAAACACAGG + Intergenic
1016336816 6:143015059-143015081 CTGCACAGGCTATGAAACATAGG + Intergenic
1019156125 6:170039937-170039959 GTGGACCAGCAAGAACACATAGG - Intergenic
1028450611 7:90977962-90977984 GGGGACAAACTAGGAAAAATAGG + Intronic
1029860463 7:103565939-103565961 GTCTACAAGTTATGAAACATAGG + Intronic
1032494156 7:132348482-132348504 GTGGAAAGGTTAGGAAACACTGG - Intronic
1036969147 8:13334514-13334536 GGAGACCAGCTAGGAAACAATGG + Intronic
1039143445 8:34419087-34419109 GATGACAAGAGAGGAAACATAGG + Intergenic
1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG + Intergenic
1042462337 8:69084082-69084104 GTAATCTAGCTAGGAAACATAGG + Intergenic
1042572623 8:70183537-70183559 GTGTATAAGCTAGGAATAATGGG - Intronic
1042995779 8:74696697-74696719 TTGCACAAACTAGGAAACCTAGG + Intronic
1044356323 8:91226194-91226216 ATTGAGAAGCTTGGAAACATAGG - Intronic
1044491459 8:92822054-92822076 TTAGACAAGTTAGAAAACATTGG + Intergenic
1045560279 8:103255208-103255230 CTGAACAAGCTAGGACAAATTGG - Intergenic
1045742216 8:105374731-105374753 GTGGACAAGCATAGGAACATAGG + Intronic
1046124082 8:109882467-109882489 GTGGTCAGCCTAGGAAGCATTGG + Intergenic
1046211128 8:111078716-111078738 GTGGAAAGGCTGGGAAATATGGG - Intergenic
1047115645 8:121839074-121839096 TTGGAATAGTTAGGAAACATTGG - Intergenic
1050714251 9:8503685-8503707 GTGGACAAATTAAGAAACAATGG - Intronic
1051121261 9:13754945-13754967 GTGGACAAGGAGGGAAGCATAGG - Intergenic
1051816681 9:21116510-21116532 GTGCATAAACTAGAAAACATAGG - Intergenic
1052979845 9:34440162-34440184 GTGCAACAGCTAGAAAACATAGG - Intronic
1062376950 9:136266189-136266211 GTGGACAGGCTTGGAAGCCTTGG + Intergenic
1186320861 X:8423592-8423614 TTGCACAAGCTTGGAAAAATGGG + Intergenic
1192055317 X:67767898-67767920 GTGGACAACCTAGAATACAAGGG - Intergenic
1195397533 X:104427285-104427307 CTGGACATGCTAGGCAACACGGG + Intergenic
1196071842 X:111532966-111532988 CTGGAAAACCTAGAAAACATGGG - Intergenic
1200042509 X:153380278-153380300 TTGGACATGTTAGGAAACAGAGG - Intergenic
1201773787 Y:17643378-17643400 GTGGCCAAGCTAGAAAAGGTGGG - Intergenic
1201827770 Y:18262611-18262633 GTGGCCAAGCTAGAAAAGGTGGG + Intergenic
1202094509 Y:21233296-21233318 GTGGACAAACTCTGGAACATGGG - Intergenic