ID: 1100486741

View in Genome Browser
Species Human (GRCh38)
Location 12:95036592-95036614
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100486741_1100486745 8 Left 1100486741 12:95036592-95036614 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110
1100486741_1100486749 17 Left 1100486741 12:95036592-95036614 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831
1100486741_1100486747 9 Left 1100486741 12:95036592-95036614 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1100486747 12:95036624-95036646 CCTCAGCCTCCTGCGTAGCTGGG 0: 551
1: 101281
2: 207380
3: 242934
4: 151516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100486741 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr