ID: 1100486742

View in Genome Browser
Species Human (GRCh38)
Location 12:95036595-95036617
Sequence AATCACTTGAATCCAGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158170
Summary {0: 79, 1: 2045, 2: 19892, 3: 49941, 4: 86213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100486742_1100486749 14 Left 1100486742 12:95036595-95036617 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831
1100486742_1100486747 6 Left 1100486742 12:95036595-95036617 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1100486747 12:95036624-95036646 CCTCAGCCTCCTGCGTAGCTGGG 0: 551
1: 101281
2: 207380
3: 242934
4: 151516
1100486742_1100486745 5 Left 1100486742 12:95036595-95036617 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100486742 Original CRISPR AATCACTTGAATCCAGGAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr