ID: 1100486743

View in Genome Browser
Species Human (GRCh38)
Location 12:95036601-95036623
Sequence CAGGAGAATCACTTGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528440
Summary {0: 2037, 1: 40996, 2: 111138, 3: 163941, 4: 210328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100486743_1100486751 27 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486751 12:95036651-95036673 CAGGCAGCTGCCACCATGCCTGG 0: 41
1: 3294
2: 22196
3: 65672
4: 131853
1100486743_1100486749 8 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831
1100486743_1100486747 0 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486747 12:95036624-95036646 CCTCAGCCTCCTGCGTAGCTGGG 0: 551
1: 101281
2: 207380
3: 242934
4: 151516
1100486743_1100486745 -1 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100486743 Original CRISPR CAGGAGAATCACTTGAATCC AGG (reversed) Intronic
Too many off-targets to display for this crispr