ID: 1100486745

View in Genome Browser
Species Human (GRCh38)
Location 12:95036623-95036645
Sequence GCCTCAGCCTCCTGCGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673782
Summary {0: 489, 1: 88463, 2: 195329, 3: 232391, 4: 157110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100486741_1100486745 8 Left 1100486741 12:95036592-95036614 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110
1100486743_1100486745 -1 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110
1100486742_1100486745 5 Left 1100486742 12:95036595-95036617 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1100486745 12:95036623-95036645 GCCTCAGCCTCCTGCGTAGCTGG 0: 489
1: 88463
2: 195329
3: 232391
4: 157110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100486745 Original CRISPR GCCTCAGCCTCCTGCGTAGC TGG Intronic
Too many off-targets to display for this crispr