ID: 1100486749

View in Genome Browser
Species Human (GRCh38)
Location 12:95036632-95036654
Sequence TCCTGCGTAGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636893
Summary {0: 308, 1: 55896, 2: 144379, 3: 233479, 4: 202831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100486741_1100486749 17 Left 1100486741 12:95036592-95036614 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831
1100486743_1100486749 8 Left 1100486743 12:95036601-95036623 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831
1100486742_1100486749 14 Left 1100486742 12:95036595-95036617 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1100486749 12:95036632-95036654 TCCTGCGTAGCTGGGATTACAGG 0: 308
1: 55896
2: 144379
3: 233479
4: 202831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100486749 Original CRISPR TCCTGCGTAGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr