ID: 1100488459

View in Genome Browser
Species Human (GRCh38)
Location 12:95054726-95054748
Sequence ATCTAGTTAGATATGTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100488459_1100488460 19 Left 1100488459 12:95054726-95054748 CCTAGCAACATATCTAACTAGAT 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1100488460 12:95054768-95054790 TTTTTTTATTGATCATTCTTAGG 0: 665
1: 980
2: 212
3: 717
4: 1528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100488459 Original CRISPR ATCTAGTTAGATATGTTGCT AGG (reversed) Intronic
904634848 1:31872000-31872022 ATCAAGTTAGAGAGGTAGCTAGG + Intergenic
906889062 1:49687257-49687279 ATCTATTTACATATATTGTTTGG - Intronic
906976921 1:50585623-50585645 ATGTAGCCAGATATCTTGCTTGG - Intronic
909809299 1:79911481-79911503 GGCTAGTTAGATATGTAGGTTGG - Intergenic
911791260 1:102018210-102018232 ATCTATTTAACTATGTTACTGGG - Intergenic
912332540 1:108832725-108832747 ATCTATTTTCATATGTTTCTTGG - Intronic
915687361 1:157647418-157647440 ATGTAATTAGATATATTTCTGGG + Intergenic
917022512 1:170604185-170604207 ATGTAGTTAAAAATCTTGCTAGG + Intergenic
917329416 1:173867031-173867053 ATCTCTTTAGGTATGGTGCTGGG - Intergenic
917820955 1:178763564-178763586 CTCTAGTTAGCTATATTCCTAGG + Intronic
1063179458 10:3584651-3584673 TTCTAGTTAGGTTTGTAGCTGGG + Intergenic
1063555678 10:7077049-7077071 ATCTGGTTAAGTTTGTTGCTAGG + Intergenic
1064506821 10:16039922-16039944 ATCTAGTTAATTTTGTTGATTGG - Intergenic
1069131149 10:64704824-64704846 ATATAGTTAAATCTGTTTCTTGG + Intergenic
1074309741 10:112312147-112312169 TTCTATTTAGCTAGGTTGCTTGG - Intergenic
1074323729 10:112427978-112428000 CTCTAGTTAGATATCTGACTTGG + Exonic
1077982805 11:7318169-7318191 CTCTTGTTAGATTTATTGCTAGG + Intronic
1079245366 11:18748505-18748527 ATTTATTTAGATATTTTTCTGGG + Intronic
1079636237 11:22744898-22744920 CTCTAGTTAGATGTATTCCTAGG - Intronic
1081178182 11:39954630-39954652 GTCTTTTTAGATATTTTGCTGGG - Intergenic
1082796011 11:57378280-57378302 AGCTAGTTAAATAGGTTTCTTGG - Intronic
1087814756 11:102646540-102646562 ATCTATTTAGATTTATTTCTGGG + Intergenic
1093105060 12:15076267-15076289 TTCTATTTTGATATGTTTCTAGG - Intergenic
1094458105 12:30661024-30661046 TGCTACTTAGTTATGTTGCTAGG - Intronic
1097586167 12:61518940-61518962 ATATAGATAGATTTGTTGATGGG - Intergenic
1098063786 12:66590461-66590483 ATCCAGTTTGCTATGTGGCTGGG - Intronic
1098365260 12:69696324-69696346 ATGTAGCTAGAAATGTTCCTTGG - Intronic
1099627605 12:85094826-85094848 TTCTGGTTAGATATATTGCTAGG + Intronic
1100461918 12:94808215-94808237 GTCTAGTTAAATGTGTTCCTTGG - Intergenic
1100488459 12:95054726-95054748 ATCTAGTTAGATATGTTGCTAGG - Intronic
1101298702 12:103454885-103454907 ACCTAGTAAGATATAATGCTGGG - Intronic
1101499722 12:105291558-105291580 ATCTATTTAGATCTTTTGCCTGG - Intronic
1103404857 12:120667879-120667901 ATGTAGTTAGTTATTTAGCTGGG + Intergenic
1106943917 13:34804305-34804327 ATCTAGTTAAATAAAGTGCTAGG + Intergenic
1107160694 13:37223761-37223783 ATTCATTTATATATGTTGCTGGG - Intergenic
1109384988 13:61616598-61616620 ATTTTGTTAAATACGTTGCTTGG - Intergenic
1109677630 13:65700056-65700078 ATTTACTTAGAAATGCTGCTTGG + Intergenic
1109993426 13:70088919-70088941 ATCTATTTACATATGTAGTTTGG + Intronic
1111887927 13:94046526-94046548 ATTTAGTCAGATTAGTTGCTTGG - Intronic
1112403744 13:99099547-99099569 AGCTAGTTAAACATGTTTCTGGG - Intergenic
1115514514 14:34172186-34172208 ATCTAGTTTGTTAAGTTTCTTGG + Intronic
1115718579 14:36134110-36134132 ATGTAGTTTGCTGTGTTGCTGGG + Intergenic
1116416117 14:44679370-44679392 AAGTAGTTAATTATGTTGCTTGG + Intergenic
1120753892 14:88223846-88223868 ATCTAGTTTAATATGTTATTTGG + Intronic
1124044209 15:26133295-26133317 CTTTCGTTAGATTTGTTGCTAGG - Intergenic
1125089992 15:35779142-35779164 AACTGGTTAAATATATTGCTTGG + Intergenic
1126723008 15:51601942-51601964 ATATCATTAGATTTGTTGCTAGG + Intronic
1130736885 15:86559786-86559808 AGCCAGACAGATATGTTGCTGGG + Intronic
1133776579 16:8900443-8900465 ATCTAGGTACAAATGTTTCTTGG + Intronic
1134151457 16:11808549-11808571 ACCTAGTTAGATATATTTTTGGG - Intergenic
1134501708 16:14774031-14774053 ATCTTGTTATATATATTTCTTGG + Intronic
1134578856 16:15354847-15354869 ATCTTGTTATATATATTTCTTGG - Intergenic
1134723731 16:16402703-16402725 ATCTTGTTATATATATTTCTTGG + Intergenic
1134943698 16:18309167-18309189 ATCTTGTTATATATATTTCTTGG - Intergenic
1135890332 16:26351373-26351395 ATCTTGTTAGATATGTGGAAAGG - Intergenic
1136402664 16:30027016-30027038 AGCTAGTAAGAGATGGTGCTGGG + Intronic
1138290669 16:55843978-55844000 ATTTTGGTAGATATCTTGCTAGG - Intergenic
1139353807 16:66354749-66354771 CTCGAGTTAGCTATGTGGCTTGG - Intergenic
1141187323 16:81797246-81797268 ATCTAGTTAAAGATGTCCCTTGG + Intronic
1143440016 17:6963753-6963775 ATCAAGTTAGATTTATTCCTGGG + Intronic
1146989843 17:37259848-37259870 AACTAGTTAGCTATGTTTCTAGG - Intronic
1148459339 17:47829591-47829613 AGCTTGTTAGAAATTTTGCTGGG + Exonic
1153012866 18:555686-555708 ATCCAGTTGGATATTTTGCCCGG + Intergenic
1154027302 18:10720633-10720655 ATCTTTTTAGAGATGTTGCTCGG + Intronic
1156299497 18:35823797-35823819 ATTTTGTTAGATTTGTTCCTAGG - Intergenic
1157711143 18:49850461-49850483 ACCTAGTTATAGATGTTGTTAGG + Intronic
1158815938 18:61096983-61097005 ATCTTGTTACATTTGTGGCTGGG - Intergenic
1164282287 19:23779444-23779466 GTATATTTTGATATGTTGCTGGG + Intronic
1164911927 19:32019801-32019823 ATCTAGTTAGAGGGGTTGGTAGG + Intergenic
1167535070 19:50044801-50044823 ACCTGGTTAGATAGTTTGCTAGG + Exonic
926443476 2:12915593-12915615 ATTTACTAAGACATGTTGCTAGG - Intergenic
927310751 2:21628504-21628526 ATCCAGTTTGATATTTTGTTTGG + Intergenic
930004740 2:46887709-46887731 GTCTATTTTGATATGTTGCTAGG - Intergenic
930623428 2:53668446-53668468 ATCTATTTCTATAGGTTGCTGGG - Intronic
930634455 2:53788700-53788722 ATCTAGGTAAATATTTTTCTGGG + Intronic
930948585 2:57108469-57108491 ATCCAGTTAGATATTTTTTTTGG + Intergenic
931378038 2:61725407-61725429 ATATAATTAGATATGATTCTTGG + Intergenic
934252123 2:90364934-90364956 ATCTAGTTAGATATCTACTTTGG - Intergenic
934257320 2:91438012-91438034 ATCTAGTTAGATATCTACTTTGG + Intergenic
938569876 2:132553206-132553228 ATATACATAGATATGTGGCTGGG - Intronic
939831309 2:147074953-147074975 AACTAGTTAGAAATATTTCTGGG - Intergenic
940896852 2:159089305-159089327 TTGTAGTTAGATATTTTACTAGG + Intronic
941223782 2:162819349-162819371 ATCTACTTATTTATTTTGCTGGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942379063 2:175368709-175368731 ATTTAGTCAAATTTGTTGCTCGG - Intergenic
943229215 2:185224545-185224567 TTTTAGCTAGATATATTGCTAGG + Intergenic
946915886 2:224520837-224520859 AACTATTTAGATATGTTGGTAGG - Intronic
1169615362 20:7437596-7437618 AATTAGTTAGATATTTTGTTTGG - Intergenic
1172381987 20:34502220-34502242 ATGTAGTTAAATATGCTGCTAGG + Intronic
1173628338 20:44490482-44490504 ATCTAGATAGTTATCTTTCTAGG - Exonic
1173711926 20:45165629-45165651 ATCTAGTATGATATTTTGCAGGG - Intergenic
1175398008 20:58680778-58680800 ATTTAGATAGAAATGGTGCTAGG - Intronic
1180825834 22:18860484-18860506 ATTTTGGTAGATATCTTGCTAGG - Intronic
1181186900 22:21114064-21114086 ATTTTGGTAGATATCTTGCTAGG + Intergenic
1181212302 22:21296429-21296451 ATTTTGGTAGATATCTTGCTAGG - Intergenic
1181652203 22:24265599-24265621 ATTTTGGTAGATATCTTGCTAGG - Intergenic
1182187340 22:28419799-28419821 ATCTAGCTATTTATGTTACTTGG - Intronic
1183052972 22:35279799-35279821 ATTTAGGTAGATTTGTTTCTGGG + Intronic
1203275976 22_KI270734v1_random:86389-86411 ATTTTGGTAGATATCTTGCTAGG - Intergenic
949843576 3:8348282-8348304 ATCTATTGATATATGTTGATGGG - Intergenic
951796103 3:26540189-26540211 ATCTAGTTAGTTATCGTCCTTGG - Intergenic
952013594 3:28931205-28931227 ATCTAGTCTAATATGTTGCAAGG - Intergenic
957692406 3:83588894-83588916 TTCTAGTCAGCCATGTTGCTGGG + Intergenic
960099035 3:113718659-113718681 ATCTAGTTAGTAATGTTTATTGG - Exonic
961060588 3:123825255-123825277 ATCTATTAAGAAATGTTGGTAGG + Intronic
961691474 3:128673184-128673206 ATATAGATATATATGTAGCTGGG - Intronic
962811540 3:138962891-138962913 AGCTAGTTAGAGATGGAGCTGGG + Intergenic
962907272 3:139815719-139815741 ATCTTGTTAGATGTATTCCTAGG + Intergenic
964376152 3:156051143-156051165 ATTTAGTTAGGTATATTCCTTGG - Intronic
964687942 3:159418305-159418327 ATCTAGATAGATATCTATCTGGG - Intronic
965913500 3:173812131-173812153 ATCTAATTAAATATTTTACTTGG + Intronic
967757478 3:193186066-193186088 CTCTAGTTACATAGGTAGCTTGG + Intergenic
974635724 4:64562619-64562641 ATATTGTTAGCTAAGTTGCTGGG + Intergenic
975507324 4:75152351-75152373 ATTTAGATAGATTTATTGCTAGG + Intergenic
976042230 4:80900526-80900548 ATCTAAATAAATCTGTTGCTAGG + Intronic
976055774 4:81064238-81064260 ATCTAGGTAGATATGCAGGTAGG + Intergenic
976450500 4:85185002-85185024 ATCTAGTGAGATAAGGTGCAAGG - Intergenic
976898433 4:90141011-90141033 AGATAGATAGATATCTTGCTGGG - Intronic
976979561 4:91209824-91209846 ATCTATATAAATATTTTGCTTGG - Intronic
977104774 4:92867773-92867795 AACCAGTTAGATATATTGTTGGG + Intronic
978633014 4:110768888-110768910 TCCTTGTTAGACATGTTGCTGGG - Intergenic
980331620 4:131417783-131417805 ATCTAGTTAGCTGTATTCCTAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
983267551 4:165523291-165523313 ATCTTGCTAGTTATCTTGCTAGG + Intergenic
984202563 4:176743988-176744010 ATCTAGTAACAAATGTTTCTGGG - Intronic
991049571 5:62258213-62258235 ATCTTGATAGATATGTTCTTAGG + Intergenic
994346387 5:98692447-98692469 CCCTAGTTAGATGTGTTCCTAGG + Intergenic
995213374 5:109566932-109566954 TTCAAGTCAGAGATGTTGCTTGG - Intergenic
997204687 5:132039420-132039442 CCCTAGTTAGCTATGTTCCTAGG + Intergenic
998524715 5:142831865-142831887 ATGTAGGTAGCTATGTTGCAAGG - Intronic
1001752817 5:174144653-174144675 ACCTAGTAAGATTTCTTGCTAGG + Intronic
1004553484 6:16672868-16672890 ATTTAGTTGGGTATGGTGCTGGG + Intronic
1004902570 6:20207714-20207736 ATATTGTTAGTTATCTTGCTGGG - Intronic
1007034963 6:38664922-38664944 ATCTTGTTAGATTTATTCCTAGG + Intergenic
1007874338 6:45079013-45079035 ATTTTGTTACATATATTGCTGGG + Intronic
1008031830 6:46705436-46705458 ATCTACTTAGATGTGTTTCAAGG + Intronic
1009355900 6:62743718-62743740 AAGTAGTTAGATATTTTGCATGG - Intergenic
1010335224 6:74673574-74673596 ATCTATTTAGATCTGATGCCAGG - Intergenic
1010556033 6:77280881-77280903 TCCTAGTTAGCTATGTTTCTAGG - Intergenic
1012149072 6:95722812-95722834 ATCTAGTGGGATATATTTCTGGG - Intergenic
1012917182 6:105182628-105182650 ATATACTAAGATATATTGCTTGG + Intergenic
1014557343 6:122850481-122850503 ATGCAGTTAGTTAAGTTGCTTGG + Intergenic
1015240629 6:131019223-131019245 ATTTTGTTAGATTTGTTCCTAGG + Intronic
1017284240 6:152656261-152656283 TTCTAGTTATATATGTTTATGGG - Intergenic
1021241305 7:18205225-18205247 ATATAATTAGATATTTTACTGGG + Intronic
1021589553 7:22246002-22246024 CTCTAGTTAGATGTATTCCTAGG - Intronic
1027507321 7:79033267-79033289 ATATAGCTATATATCTTGCTTGG - Intronic
1033389420 7:140912347-140912369 ATGTGGTTAGAAATGCTGCTAGG - Intronic
1038085239 8:24188901-24188923 ATATAGATAGATTTGTTGCAGGG - Intergenic
1041143988 8:54852498-54852520 ATGTAGTTAGATATTCTGCAAGG - Intergenic
1044250003 8:89995414-89995436 ATCTAGTGAGACATGTAGCTTGG + Intronic
1048334019 8:133489923-133489945 ATCTAGTTAGAGATATTCCATGG - Intronic
1051898939 9:22017866-22017888 CTTGAGTTAGATATGTTGATGGG + Intronic
1055883928 9:81036617-81036639 AAATAGTAAGATATGTTGATAGG + Intergenic
1057589110 9:96356571-96356593 ATCTAGATAGATAGCTGGCTGGG + Intronic
1057853948 9:98588231-98588253 ATTCAGTTGGATATGGTGCTGGG - Intronic
1058214019 9:102210010-102210032 ATCTATTTAGATATTTAGCTTGG + Intergenic
1058359693 9:104129623-104129645 ATCTATTTTTATATGTGGCTAGG + Exonic
1059597029 9:115732127-115732149 ATCTATTTATGTATGTTGATGGG - Intergenic
1061337780 9:129953188-129953210 ATTTAGTTAGAAATCTTGCCAGG + Intronic
1186315714 X:8367857-8367879 ATGATGTTAGATATTTTGCTTGG - Intergenic
1186800330 X:13086194-13086216 GTCTACTTAGAAATGTTTCTTGG + Intergenic
1188182284 X:27071521-27071543 ATGTAGTAAGATATGCAGCTGGG + Intergenic
1189835253 X:45013992-45014014 ATCTATTGAGAAATGTTTCTGGG + Intronic
1190402021 X:50046595-50046617 ATCTAGTTAGAAATCTAGGTGGG + Intronic
1190908957 X:54754693-54754715 ATTTAGTTATTTGTGTTGCTGGG - Intronic
1191041259 X:56083030-56083052 ATCTAGTTAATTAAGTTTCTTGG + Intergenic
1192775662 X:74241895-74241917 ATCCAGTCTGAAATGTTGCTGGG - Intergenic
1194109043 X:89808898-89808920 ATCTACTTAGAACTGTTACTAGG + Intergenic
1198367869 X:135960381-135960403 GTCTGGTTAGATATGCTTCTGGG - Intergenic
1198393471 X:136200199-136200221 ATACAGTTAGAAATGTGGCTGGG - Intronic
1198637678 X:138717417-138717439 ATCTAGCTAGGTATGTGGGTTGG + Intronic
1199142311 X:144327561-144327583 ATATATTTAGATAGGTTGCATGG - Intergenic
1200461705 Y:3463636-3463658 ATCTACTTAGAACTGTTACTAGG + Intergenic
1200839986 Y:7771822-7771844 TTATAGTTAGATGTGTGGCTTGG + Intergenic