ID: 1100494467

View in Genome Browser
Species Human (GRCh38)
Location 12:95111575-95111597
Sequence AAGTAGGACTGGAGATGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100494467 Original CRISPR AAGTAGGACTGGAGATGAGT GGG (reversed) Intronic
901071206 1:6519644-6519666 AATTAAGACTGGGGCTGAGTCGG - Intronic
904430268 1:30459812-30459834 AGGGAGAACTGGAGATGACTGGG + Intergenic
905098949 1:35501538-35501560 AGGTAGGACTTGGGATGAGGAGG - Intronic
907807479 1:57836026-57836048 AAGTATGACTGGCCTTGAGTTGG - Intronic
908019102 1:59881440-59881462 CATAAGGACTTGAGATGAGTTGG - Intergenic
910294170 1:85627997-85628019 AAGTAGGACCAGAGAGGACTGGG - Intergenic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
911883214 1:103267798-103267820 AACTTGGACTGGGGATGTGTGGG + Intergenic
911934072 1:103944313-103944335 ATATAGGACTGGAAATGAATTGG + Intergenic
912443584 1:109716538-109716560 TAGTAGGGCTGGAGATGTGATGG + Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
913589178 1:120306348-120306370 GAGTAGGAGTTGAGTTGAGTGGG + Intergenic
913619007 1:120592020-120592042 GAGTAGGAGTTGAGTTGAGTGGG - Intergenic
914226180 1:145721195-145721217 AACTAGGAGGGGAGATGAGGGGG - Intronic
914571200 1:148918234-148918256 GAGTAGGAGTTGAGTTGAGTGGG + Intronic
914601631 1:149212042-149212064 GAGTAGGAGTTGAGTTGAGTGGG - Intergenic
915549238 1:156623189-156623211 AAGTAGCACTTGTGATGAGGGGG + Intronic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
920755229 1:208723820-208723842 AAGTAGGACTTGGGTTTAGTAGG - Intergenic
921526122 1:216220740-216220762 AAGGAGCAATGGAAATGAGTAGG + Intronic
923200331 1:231704799-231704821 AAGTAGGACTGGGGTGGGGTGGG + Intronic
1064551350 10:16503930-16503952 AAATTGGCGTGGAGATGAGTTGG - Intronic
1066313242 10:34218736-34218758 ATGGAGGACAGGAGATGAGGAGG + Intronic
1070176402 10:73973859-73973881 TAGGAGGACTGCAAATGAGTAGG + Intergenic
1071713262 10:88070555-88070577 AAACAGGACTGGAGATGCGCTGG - Intergenic
1071820989 10:89280594-89280616 AACTCTGACTGGAGATGAATGGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1073677346 10:105662959-105662981 ATTTAGGACTGGAGTGGAGTCGG - Intergenic
1075229926 10:120667220-120667242 GAGCAGGTCTGGAGCTGAGTCGG + Intergenic
1075330262 10:121568948-121568970 AAGCAGGAATGGAGAGGCGTGGG - Intronic
1075863907 10:125701701-125701723 AAGGAGGACTGTGGATCAGTTGG - Intergenic
1078457578 11:11487119-11487141 AAGGGGGAGGGGAGATGAGTGGG - Intronic
1081517092 11:43843631-43843653 GAGAAGAACTGGAGAGGAGTTGG - Intronic
1083159409 11:60845540-60845562 AAGTGAGCCTGGAGATGGGTGGG + Intronic
1084386341 11:68844878-68844900 CAGTAGGACTGGGCAGGAGTGGG - Intergenic
1084950412 11:72662248-72662270 AATTAGCACTGAAAATGAGTTGG + Intronic
1086596594 11:88579464-88579486 AGGTAGAACTGGATATGAGGGGG + Intronic
1086929042 11:92672217-92672239 GAGTAGGTCTGGGGATGAGAAGG - Intronic
1087384897 11:97458598-97458620 AAGCAGGACTGGAAAAGTGTAGG + Intergenic
1087544793 11:99571164-99571186 AAGAAGGCCTGGACATGTGTAGG + Intronic
1088030073 11:105237745-105237767 AAGTAGGGCAGGAGATTACTGGG + Intergenic
1088733706 11:112707703-112707725 AAGTGGGAGAGCAGATGAGTAGG - Intergenic
1089799707 11:121015519-121015541 AAATATTACTGGAGATAAGTGGG + Intergenic
1092057951 12:5522883-5522905 AAGCAGGGCTGGAGATGGGAGGG - Intergenic
1093098082 12:14994961-14994983 AAGTTGGGATGGAGATGTGTGGG + Intergenic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1095735225 12:45548714-45548736 AAGAAGGACTGGATAGGAGAAGG + Intergenic
1097234563 12:57530415-57530437 AAGCAGTATTGGACATGAGTTGG + Exonic
1099859755 12:88211298-88211320 AACTTGGAATGGAGATGTGTGGG - Intergenic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1101421553 12:104555298-104555320 AATGGGGAGTGGAGATGAGTAGG + Intronic
1102429021 12:112867314-112867336 AAGCAGGACTGGGGAAGAGAAGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1105959463 13:25317166-25317188 AAGTGAGACTAGAGATGAGAAGG + Intronic
1107242676 13:38255769-38255791 AAGTGGGACTAGAGATAATTGGG - Intergenic
1108911976 13:55565645-55565667 AAGTAGGAATGCAGATAAGTAGG + Intergenic
1109602308 13:64647792-64647814 AAGGAGTACAGGAGATGTGTAGG + Intergenic
1110307127 13:74001276-74001298 AAGTAGTGCTGGAGATTACTGGG - Intronic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1119993310 14:79224654-79224676 AGGTCACACTGGAGATGAGTGGG + Intronic
1123141388 14:106082472-106082494 AACTAGCACTGGAGAATAGTGGG - Intergenic
1123199816 14:106651833-106651855 AACTAGCACTGGAGAGTAGTGGG - Intergenic
1124035461 15:26049783-26049805 ATTTAGGACTGGAGTTGGGTAGG - Intergenic
1126827889 15:52569417-52569439 ACGTAGGACTGGAGATGTGAAGG - Intronic
1127311217 15:57753810-57753832 AAGTAGTACTGGAGCTGAGGCGG + Intronic
1127518066 15:59715382-59715404 AAGGAGGACTGCAGCTGACTGGG - Intergenic
1128038510 15:64548670-64548692 AAGTAGGACTTGAGCTCAGGAGG + Intronic
1128859422 15:71053518-71053540 AAGTAGGTGTGAATATGAGTTGG + Intronic
1130111837 15:80971791-80971813 AAGTAGGACCTGAGACAAGTAGG + Intronic
1131432609 15:92398859-92398881 AAGAACCACTGGGGATGAGTTGG - Intronic
1135407825 16:22210761-22210783 AAGTTGGCCAGGGGATGAGTAGG + Intronic
1136004646 16:27320446-27320468 GTGCAGGAATGGAGATGAGTGGG + Intronic
1136281154 16:29212257-29212279 AAGCAGAATTGGAGATGAGAGGG + Intergenic
1137684957 16:50380362-50380384 AATTATGTCTGGAGATTAGTGGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1140176751 16:72668432-72668454 AAGTAGGCCTGGAGAGGTGGTGG + Intergenic
1141311481 16:82917494-82917516 AAGAAGGAGTGGAAATGAGGGGG + Intronic
1142085517 16:88178180-88178202 AAGCAGAATTGGAGATGAGAGGG + Intergenic
1142767430 17:2073022-2073044 AAATAGAACTGGGGATGAGGAGG + Intronic
1147441527 17:40450413-40450435 AAGTAGGGCTGGAGATCACCTGG - Intronic
1148336758 17:46847246-46847268 AAATAGGACTGAAGCTAAGTGGG - Intronic
1150670020 17:67186172-67186194 AAGTAGGAAAAGAGAAGAGTTGG - Intronic
1150813311 17:68373831-68373853 AAGGAGGACTGGAGGTGGATGGG + Intronic
1150851274 17:68705842-68705864 CTGTAAGGCTGGAGATGAGTTGG + Intergenic
1151272808 17:73009971-73009993 AAGGAGCCCAGGAGATGAGTAGG + Intronic
1152622263 17:81371046-81371068 AAGTCAGACTGGAGTAGAGTGGG + Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1155862969 18:30927300-30927322 AAGCAGAAATGGAGATGTGTAGG - Intergenic
1156745326 18:40384148-40384170 AAGCAGTACTAGAGATGAGTTGG + Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1158979295 18:62743404-62743426 AAGTAAGACTGGCCATGAGTTGG - Intronic
1159259277 18:65990842-65990864 AAGAACAACTGGAGATGACTGGG + Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1161777648 19:6272454-6272476 AGCCAGGACTTGAGATGAGTAGG - Intronic
1163152668 19:15424389-15424411 GAGGGGGACGGGAGATGAGTGGG + Intronic
1163826285 19:19526603-19526625 GATTAGGACAGGATATGAGTGGG + Intronic
1167539914 19:50079212-50079234 AGGAAAGAGTGGAGATGAGTAGG - Intergenic
1167629788 19:50618556-50618578 AGGAAAGAGTGGAGATGAGTAGG + Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926810757 2:16753372-16753394 AAGTTGGAATGGGGATGTGTGGG - Intergenic
927778906 2:25923796-25923818 AAGTAGGAGTGGAGTCGAATGGG - Intergenic
929541688 2:42827967-42827989 AAGAAGGTCTGGAGAGGAGGAGG + Intergenic
933840741 2:86284009-86284031 AAGTAGGCCTGGGGGTGAGGGGG + Intronic
934953045 2:98592344-98592366 AAGGAAGATTGGAGAGGAGTGGG + Intronic
935700926 2:105811277-105811299 ATATAGGATTGGAGTTGAGTGGG + Intronic
935953037 2:108348273-108348295 AACTAGGACTGGAGATGGTAAGG - Intergenic
937785550 2:125890357-125890379 AACTAGGAATGGGGATGTGTGGG - Intergenic
937878974 2:126850880-126850902 AAGCAGGCCTGGAGAGGACTTGG + Intergenic
938593191 2:132760091-132760113 TAATAGAACTGGAAATGAGTGGG - Intronic
944914554 2:204344744-204344766 AAGTAACTCTGGAAATGAGTGGG + Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945923452 2:215779669-215779691 AAGTGGGACTTGAGTTGAGCAGG - Intergenic
945975374 2:216266404-216266426 AAGGAGGAAGAGAGATGAGTGGG - Intronic
946891325 2:224280321-224280343 GAGATGGACTGGAGAGGAGTTGG - Intergenic
948340733 2:237249181-237249203 AAGTTGGAATGGGGATGTGTAGG - Intergenic
948695156 2:239729550-239729572 AGGTAGGACTGGAAAGGAGGTGG - Intergenic
948920994 2:241065869-241065891 AAGTGGGACTGGGGAGGAATGGG + Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1173142480 20:40496127-40496149 AAGTGTGACGGAAGATGAGTAGG - Intergenic
1175182122 20:57156174-57156196 ACGTAGGACTGGAGAGTAGCTGG + Intergenic
1176243882 20:64088211-64088233 AGGTAGGACTGGAGCTGGCTGGG + Intronic
1177228055 21:18282893-18282915 AGGAAGGACTGGAGATGTGGGGG + Intronic
1177505968 21:22017208-22017230 AAGTTGGAATGGGGATGTGTGGG - Intergenic
1178012278 21:28302218-28302240 AAGTTGGAATGGGGATGTGTGGG + Intergenic
1178018389 21:28378871-28378893 AAGTAGGGCTGCAGAGGAGCAGG + Intergenic
1179080717 21:38168518-38168540 AACTAGGACTGGAGGTGACCAGG - Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
949702311 3:6773486-6773508 GAGAAGGACTGAAGATGAGTAGG + Intronic
951374646 3:21898867-21898889 CAGTAAAACTGGAGATGCGTAGG - Intronic
952438805 3:33301255-33301277 AAGTAAGACTGAAGGTGAATAGG - Intronic
954730232 3:52654345-52654367 AAGTAGAACTGGTGAAGAGAAGG - Intronic
955096318 3:55801689-55801711 AAGTAGGACTGGCTATAATTTGG + Intronic
958150249 3:89684086-89684108 AAGTAGGAAGGGAAAGGAGTTGG - Intergenic
958692962 3:97491717-97491739 AAGTAGGCCTGGGGATGACTGGG - Intronic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
959627673 3:108471140-108471162 AAGGAGGAAAGGAGATGGGTAGG + Intronic
960605102 3:119497066-119497088 AAGGAGGACTTGAAATGGGTAGG - Intergenic
960715415 3:120570017-120570039 AAGTAGGAATGGAGAAGAGGGGG + Intergenic
962349534 3:134646637-134646659 AAATAGGATTGCAGATGAATAGG - Intronic
963383399 3:144559607-144559629 ACGAAGAACTGGAGATTAGTAGG - Intergenic
963941661 3:151101873-151101895 AAATAGGACTGGAGAAGAATTGG + Intronic
965829239 3:172765164-172765186 AACAAGGACTGCAGATCAGTTGG - Intronic
965904228 3:173683259-173683281 AAGGAGGACTTGAAATGTGTAGG - Intronic
966758091 3:183390262-183390284 AAAAAGGAATGGAGATAAGTAGG - Intronic
967286756 3:187878931-187878953 AAGTAGGATTAGAGAAGGGTGGG - Intergenic
969207448 4:5657379-5657401 TGGAAGGACTGGAGAGGAGTTGG - Intronic
969297371 4:6277910-6277932 GAGAAGGACTGCAGAGGAGTGGG - Intronic
976052744 4:81028614-81028636 AAGGAGGACTGGAGCTGAGGGGG + Intergenic
977909049 4:102510993-102511015 AAGCAGGATTGGAGATGAGGAGG + Intronic
978417173 4:108488807-108488829 AAGGAGGAATGGAAGTGAGTGGG - Intergenic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
979159354 4:117439583-117439605 AAGTAGAACTGTAGAAGAGTAGG + Intergenic
984411647 4:179404939-179404961 AAGCAGGACTGGGCATGAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986573675 5:9191105-9191127 AAGAAGAACAGGAGATGAGGAGG + Intronic
986767193 5:10938893-10938915 AAACAGGACTGGAGATGTGCTGG - Intergenic
988005510 5:25405254-25405276 AATTTGGAATGGAGATGTGTGGG - Intergenic
988660792 5:33266002-33266024 AAGTATCACTGGAGATAAGAAGG + Intergenic
990128462 5:52548708-52548730 GAGTAGGAGTGCAGGTGAGTAGG - Intergenic
990196074 5:53317911-53317933 AAATAGGACTAGAGCTGAGGAGG + Intergenic
991258530 5:64641973-64641995 AAGAAAGACTGGTGGTGAGTAGG + Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
992621579 5:78599102-78599124 AGCAAGGGCTGGAGATGAGTAGG - Intronic
993528980 5:89002418-89002440 GAATAGGACCGGGGATGAGTGGG - Intergenic
993582128 5:89676063-89676085 AAATAGGAATTCAGATGAGTTGG - Intergenic
993761086 5:91798427-91798449 AACTAGGATTAGAGATGATTTGG - Intergenic
994717488 5:103339414-103339436 AATTCGGAATGGAGAAGAGTGGG - Intergenic
996872643 5:128208743-128208765 AAGTTGTACTGGAGAGCAGTAGG - Intergenic
1000730420 5:164828260-164828282 AAGTTGGAATGGGGATGTGTGGG + Intergenic
1001160816 5:169311140-169311162 AAATATGACTGGACAGGAGTTGG - Intergenic
1003696264 6:8408797-8408819 AACTTGGAATGGAGATGTGTGGG - Intergenic
1006568236 6:34978258-34978280 AAGTGGGTCTTAAGATGAGTAGG + Intronic
1007527559 6:42509804-42509826 GAGTCGGAATGGAGCTGAGTGGG + Intergenic
1012033108 6:94098369-94098391 AAGTAGAAATGGGGATGTGTGGG + Intergenic
1013234540 6:108185796-108185818 AAGTGGGAGAGTAGATGAGTGGG + Intronic
1013598371 6:111681607-111681629 AGGTGGGACTGGAGCTGAGGAGG - Intronic
1013724501 6:113076908-113076930 CAACAGGACTGGAGATGAGCAGG + Intergenic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1016486059 6:144541047-144541069 AAGAAGCAGGGGAGATGAGTGGG - Intronic
1016636512 6:146298336-146298358 AAGCAGCCCTGGAGTTGAGTAGG - Intronic
1016834096 6:148459655-148459677 AAGAAGGACTGAGGATGACTTGG + Intronic
1019688839 7:2398375-2398397 AAGGAGGAAGGGAGAGGAGTTGG - Intergenic
1021425456 7:20495029-20495051 AAGGTCAACTGGAGATGAGTTGG - Intergenic
1022656820 7:32327026-32327048 AAGTAGGAATGAAGATGACTCGG - Intergenic
1023632418 7:42177557-42177579 ATGTAGAACTGGAGCTCAGTGGG - Intronic
1024332371 7:48169088-48169110 AAGTTGGAATGGAGATATGTGGG + Intergenic
1026319320 7:69255223-69255245 AATGAGGACTGGAAATGAGGTGG + Intergenic
1028449482 7:90965152-90965174 AAGTGGGGATGGGGATGAGTGGG - Intronic
1028743140 7:94298905-94298927 AAGGAAGACTGGAGATGAAGTGG - Intergenic
1029819657 7:103133602-103133624 AAGTAGGAATGAGGAAGAGTGGG + Intronic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1030881925 7:114890303-114890325 ACGTATGACTGGGGAAGAGTGGG - Intergenic
1031065554 7:117101237-117101259 AACTCGGAATGGAGATGTGTGGG - Intronic
1031584670 7:123520000-123520022 AAGGGGGACTGGTAATGAGTAGG - Intronic
1033169860 7:139073948-139073970 AAGAAGGAGTGGAGAGGCGTCGG + Exonic
1034300356 7:150009887-150009909 AAGAAGGACTGAATATGGGTTGG - Intergenic
1034805697 7:154087421-154087443 AAGAAGGACTGAATATGGGTTGG + Intronic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1037562153 8:20084616-20084638 AACTAGGACTGAACATTAGTTGG - Intergenic
1037730111 8:21517166-21517188 CAGTTGGACTGGTGATGAGCAGG + Intergenic
1042243283 8:66686405-66686427 AAGTAGCACTTTAGATCAGTGGG - Intronic
1042540903 8:69906231-69906253 AAGTGGGTTTGGAGATGAGTCGG - Intergenic
1043150838 8:76713990-76714012 AAGTAGGAGTTGACATGAATGGG - Intronic
1047787399 8:128167325-128167347 AATGAGGACAGGAGTTGAGTAGG + Intergenic
1049916970 9:327233-327255 AAGCAGCACTGGAGATGGATGGG - Intronic
1050522602 9:6517316-6517338 AAGTAGGACTGAAGAGGAAAGGG - Intergenic
1051696553 9:19774111-19774133 AGATAGGACTGAAGAAGAGTAGG + Intronic
1053320910 9:37098175-37098197 TAGTAGGACTGGAATTTAGTAGG - Intergenic
1055261094 9:74434682-74434704 AGGTTGAACTGGAGATGGGTGGG - Intergenic
1055858350 9:80718900-80718922 AAGTAGTACTGGATTAGAGTGGG - Intergenic
1056986359 9:91366969-91366991 AAGCAGGTCAGGAGATTAGTGGG - Intergenic
1057143540 9:92743118-92743140 AAGAAGTCCTGGAGAGGAGTGGG - Intronic
1060416882 9:123437047-123437069 AAGTGGGCCTGGAGATGAAGAGG + Intronic
1062086954 9:134653934-134653956 ATGTAGGGCTGGAGGTGTGTAGG + Intronic
1187933663 X:24315601-24315623 ATTTAGGACTGAAGATAAGTGGG + Intergenic
1190157612 X:48006497-48006519 AAGGATGACTAGAGATGACTGGG + Intronic
1190173384 X:48129382-48129404 AAGGATGACTAGAGATGACTGGG + Intergenic
1190796072 X:53743855-53743877 AAGTAGGATTGAAAATGAGGGGG - Intergenic
1190928477 X:54929223-54929245 AAGTGGCACTGGTGCTGAGTGGG - Exonic
1195022344 X:100842198-100842220 AAGTTGAACTGGGGATGAGCAGG - Intergenic
1195720091 X:107858942-107858964 AAGAAAGAAAGGAGATGAGTTGG + Intronic
1198005368 X:132488830-132488852 AGGTAAGGCTGGAGATGAATTGG - Intronic
1198684582 X:139214034-139214056 GAGAAGAACTGGATATGAGTAGG + Intronic
1199621571 X:149706064-149706086 AAATGGGACTGGAGGTGAGCTGG - Intronic
1200057042 X:153467150-153467172 AGGCAGGACTGGAGATGGCTGGG - Intronic
1201436189 Y:13961083-13961105 AAGTAAGACTGGAGTTAAATGGG + Intergenic
1201910621 Y:19130009-19130031 AAGTAGTAATGGAGAAGTGTAGG - Intergenic