ID: 1100499510

View in Genome Browser
Species Human (GRCh38)
Location 12:95160336-95160358
Sequence TTTTTATTATAGCCATTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 1, 2: 6, 3: 76, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100499510_1100499515 27 Left 1100499510 12:95160336-95160358 CCACACAATGGCTATAATAAAAA 0: 1
1: 1
2: 6
3: 76
4: 454
Right 1100499515 12:95160386-95160408 TGGTGAGGATGTGGACCAACTGG 0: 3
1: 128
2: 562
3: 3418
4: 23923
1100499510_1100499512 12 Left 1100499510 12:95160336-95160358 CCACACAATGGCTATAATAAAAA 0: 1
1: 1
2: 6
3: 76
4: 454
Right 1100499512 12:95160371-95160393 GTAAATACCTAGTGTTGGTGAGG 0: 1
1: 0
2: 12
3: 232
4: 975
1100499510_1100499513 18 Left 1100499510 12:95160336-95160358 CCACACAATGGCTATAATAAAAA 0: 1
1: 1
2: 6
3: 76
4: 454
Right 1100499513 12:95160377-95160399 ACCTAGTGTTGGTGAGGATGTGG 0: 1
1: 35
2: 497
3: 1601
4: 4073
1100499510_1100499511 7 Left 1100499510 12:95160336-95160358 CCACACAATGGCTATAATAAAAA 0: 1
1: 1
2: 6
3: 76
4: 454
Right 1100499511 12:95160366-95160388 AAACAGTAAATACCTAGTGTTGG 0: 1
1: 0
2: 11
3: 164
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100499510 Original CRISPR TTTTTATTATAGCCATTGTG TGG (reversed) Intronic
901128335 1:6945025-6945047 TTTTTATTATGTGCATTGTCTGG + Intronic
903523203 1:23970996-23971018 TTTTAATTATAACCATTGCCTGG + Exonic
903531821 1:24036783-24036805 TTTTAAATGTAGCCATTCTGAGG + Intergenic
905109175 1:35582185-35582207 TTTTTATTATAACCATCAAGTGG + Intronic
905757783 1:40526112-40526134 TTTTGATAATAGCCATCCTGAGG - Intergenic
906200343 1:43956253-43956275 TTTCTCTTAAAGCCAGTGTGGGG + Intronic
906831799 1:49040281-49040303 TTTTTATTATAGCCTTTTAGTGG - Intronic
907817472 1:57934231-57934253 TTTTAATTTTAGCCATTTGGTGG + Intronic
907928487 1:58977074-58977096 TCTCTTTTATAGCCATTGTGAGG - Intergenic
908407032 1:63824993-63825015 TTTTAATCATAGCCATTCTGTGG - Intronic
908529881 1:65024279-65024301 TTTTTATTACAGCCATCCTAGGG + Intergenic
908812451 1:67997240-67997262 TTTTTATTTTAGCCATTTTTAGG + Intergenic
908883966 1:68766371-68766393 TTTTAACTTTAGCCATTCTGTGG - Intergenic
908923009 1:69219151-69219173 TATTTTGTATAGTCATTGTGGGG - Intergenic
909137950 1:71825164-71825186 TTTTGATTTTAGTCATTCTGGGG + Intronic
909169635 1:72279439-72279461 TTTTTATTAAAGACACTGTGAGG + Intronic
909462605 1:75935369-75935391 TTTTTATTTTACCCATTTTATGG + Intergenic
909761547 1:79294020-79294042 TATTTGGTACAGCCATTGTGGGG + Intergenic
910910259 1:92226073-92226095 TTTTTAGTACATCCACTGTGAGG + Intronic
910959310 1:92744848-92744870 TTTTTATTACAGCAATTCTCAGG + Intronic
911442280 1:97941984-97942006 TTTTTATTATAGCCATGTAATGG + Intergenic
911614680 1:99996515-99996537 TTTTTATTTTTGCCAATTTGAGG - Intronic
911629081 1:100162073-100162095 TTTTTATTATAGCCATCTAGTGG + Intronic
911640839 1:100287241-100287263 TTTTTATTTTAGCCAATTTTGGG + Intronic
916703564 1:167323018-167323040 TTTTGTTTATGGCCATTTTGGGG + Intronic
917201726 1:172524362-172524384 TTTTTATAATGGCAATTTTGCGG - Intergenic
917951867 1:180046743-180046765 TTTTTGTTATAGCCATCTTAGGG + Intronic
918608393 1:186457749-186457771 AATTTGTTATAGCCATTTTGAGG - Intronic
918712769 1:187751612-187751634 TTTTGATTATAGGCATTCAGGGG - Intergenic
919584527 1:199419682-199419704 TTTCAATAATAGCCATTCTGGGG - Intergenic
919821376 1:201474761-201474783 TTTTAAATATAGCCATAGTGGGG + Intergenic
920280098 1:204836643-204836665 TTGTTATAATACCTATTGTGTGG + Intronic
920601718 1:207332216-207332238 TATTTATTATATCAATGGTGTGG + Intronic
921233625 1:213100139-213100161 TTTTAATTTTAGCCATTCTGGGG + Intronic
921462670 1:215447257-215447279 TTTTTATTATTGACATTTTATGG - Intergenic
921704988 1:218312287-218312309 TTTTTTTTTTAGCCATTGAGCGG + Intronic
921735683 1:218625208-218625230 TTTTTATTTTAACCATTGATAGG - Intergenic
922245536 1:223793124-223793146 TTTTCCTTTTAGGCATTGTGGGG - Intronic
923347935 1:233074885-233074907 TTTTTATTGTAGCCATTCTGAGG - Intronic
923359444 1:233195193-233195215 TTTTTTTTAAAGCAATTGTTAGG - Intronic
923938394 1:238791186-238791208 TTTTTATCATATCAATTGAGAGG + Intergenic
924090220 1:240493548-240493570 TTTTTATTTTAGACATGGTCTGG + Intronic
924291587 1:242542208-242542230 TATTTCTTATAGCCATTATATGG + Intergenic
924849681 1:247813941-247813963 TTTTAATTATAGTTATTTTGAGG - Intergenic
1063125510 10:3133377-3133399 GTCTTATTTTAGCCATTGTGGGG + Intronic
1063445783 10:6115037-6115059 TTTTTATGACAGGCATTGTTAGG - Intronic
1063590365 10:7389349-7389371 TTTTAATAATAGCCTTTTTGGGG - Intronic
1064441306 10:15356266-15356288 TTTAAATTTTAGCCATTTTGAGG - Intronic
1064608369 10:17069505-17069527 TTTTTATTATAGCTATCCTATGG + Intronic
1064717629 10:18193373-18193395 TTTCGATTATAGCCATCCTGTGG + Intronic
1065593693 10:27291619-27291641 TTATTATTGTAGCAAATGTGTGG + Intergenic
1065598481 10:27343139-27343161 TATTTATAAAAGCCATTGTATGG + Intergenic
1065656660 10:27958644-27958666 TTATTATTGTAGCAAATGTGTGG - Intronic
1065769986 10:29069155-29069177 TCATTATCAGAGCCATTGTGGGG + Intergenic
1065986622 10:30959952-30959974 TTTTTATTACAGCCATCCTAGGG + Intronic
1066565841 10:36720853-36720875 TTTTTATTTTAGCCATTATAGGG - Intergenic
1066667731 10:37802520-37802542 TTTTTCTTTTAGCCAATGGGAGG - Intronic
1067261328 10:44694856-44694878 TTTTGATAATAGCCATTTTGGGG + Intergenic
1068040770 10:51821260-51821282 TTTGGATTATTGCCATTTTGAGG + Intronic
1068153665 10:53168189-53168211 TCTTTATTTTAGCCATTTTTAGG + Intergenic
1068631173 10:59299054-59299076 TATTAATTATAGTCACTGTGTGG - Intronic
1068889066 10:62129671-62129693 TTTTAGTTATAGCCATCCTGGGG - Intergenic
1069674071 10:70234540-70234562 TTTTTACAATAGACATTGTTTGG - Intergenic
1071250216 10:83810330-83810352 TTCTCATTATTGCCAATGTGTGG - Intergenic
1071363820 10:84878510-84878532 TTCTTATTATTCCCCTTGTGGGG + Intergenic
1071413659 10:85421211-85421233 TTTTTATTATATCCATTTCAAGG - Intergenic
1071766890 10:88676807-88676829 TTCTTATTACAGCAAGTGTGAGG - Intronic
1072592818 10:96843048-96843070 TTTTTATTGTTGCCATTGCATGG + Intronic
1072894289 10:99352544-99352566 TTTTTATTATTGCCATCTTGTGG + Intronic
1073093060 10:100960434-100960456 TTTTTACTAAAGCCATAGTAGGG + Intronic
1073781053 10:106838901-106838923 TTTCTATTATAATCATTTTGGGG + Intronic
1074141582 10:110678154-110678176 TCTTTCTTATAGACAATGTGGGG + Intronic
1074905644 10:117861148-117861170 TTTTTATTCTACCTATTGTATGG - Intergenic
1075583617 10:123641633-123641655 TTTGGATTATATCCATTCTGTGG - Intergenic
1076143284 10:128096627-128096649 TTTTTATTATAGGGAGAGTGGGG - Intergenic
1077149557 11:1064383-1064405 TTTTTATAAATGCCATTATGAGG - Intergenic
1077901541 11:6493993-6494015 TTTTTATTACAGCATTTGTGTGG + Intronic
1078192848 11:9106908-9106930 TTTTTCTTTTAGCATTTGTGAGG - Intronic
1078312681 11:10261123-10261145 TTTTGATTTTAGCCATTTTGAGG - Intronic
1078651281 11:13195973-13195995 TTTTGATTTTAGCCATTCTGAGG - Intergenic
1078775601 11:14390893-14390915 TTTTCATTATAACCATCCTGGGG + Intergenic
1078966249 11:16347414-16347436 TATTTATAGTAGCCATTGTTAGG - Intronic
1079849086 11:25507048-25507070 TTTTAATTATAACCATAGTTTGG - Intergenic
1080198226 11:29636767-29636789 TCTTACTTATAGCCCTTGTGAGG - Intergenic
1080541878 11:33273759-33273781 TCTTTATGAAAGACATTGTGGGG - Intronic
1080733953 11:34991484-34991506 TATTTTTTATAACCATTGTGTGG + Intronic
1081418199 11:42840876-42840898 TTTTTATTATCCCCACTTTGGGG + Intergenic
1081457534 11:43239546-43239568 TTTTAATAATAGCCATTCTGAGG + Intergenic
1081699864 11:45146321-45146343 ATTTTAATAAAGTCATTGTGAGG - Intronic
1082192357 11:49261857-49261879 TTTTTAGTATCTCCATTGTTTGG + Intergenic
1084753418 11:71219564-71219586 TTTTTAAAATAGCCATTCTAGGG - Intronic
1084803535 11:71563525-71563547 TTTTGATAATGGCCATTCTGTGG + Intronic
1085496215 11:76972265-76972287 TTTTTAGTATAGCCATCTTGTGG + Intronic
1085581547 11:77655385-77655407 TTTTTATTATGGCTATTCTAGGG - Intergenic
1085871371 11:80354006-80354028 TTATTATTATAGCTATTATGTGG - Intergenic
1086057039 11:82658899-82658921 TTTTGATAATAGCCATTCTAAGG - Intergenic
1086151688 11:83618516-83618538 TTTCTATTATACCCATTTTATGG + Intronic
1086599488 11:88615255-88615277 TTTTTATTATTATCATTTTGAGG - Intronic
1086673768 11:89579102-89579124 TTTTTAGTATCTCCATTGTTTGG - Intergenic
1086946755 11:92851454-92851476 TTTTTAATTTAGTCACTGTGTGG - Intronic
1087339635 11:96887228-96887250 TTTGTATTCTAGTGATTGTGAGG - Intergenic
1087487893 11:98781371-98781393 GTTTTATTAAAGCCATGATGGGG + Intergenic
1088975544 11:114813176-114813198 TTTTGATTATAACCACTGGGTGG - Intergenic
1089234609 11:117012716-117012738 TTACTATTATAGAGATTGTGAGG - Intronic
1089423996 11:118354643-118354665 ATTTTAATATAGCCATTCTATGG + Exonic
1089434293 11:118451043-118451065 TATTTATGATAGCCATTTTTAGG - Intronic
1090518957 11:127458563-127458585 TGATTATTATAGCCATTGCAGGG + Intergenic
1091608482 12:1979785-1979807 TTTTAATTTTAGCCATTCTAAGG + Intronic
1091997611 12:5006839-5006861 TTTTTATCATAGCCATTCTTAGG - Intergenic
1093517243 12:20003198-20003220 TTTTGATAATAGCCATTCTGGGG + Intergenic
1093623646 12:21321756-21321778 ATTTTATTACTTCCATTGTGAGG + Intronic
1094280126 12:28727715-28727737 TTATTATTCTACCCATTATGGGG - Intergenic
1095353118 12:41238734-41238756 TTTTAATAATAGCCATTCTGAGG - Intronic
1095841202 12:46695117-46695139 TTTTTACAATAGCCATTGTAAGG + Intergenic
1097833371 12:64249181-64249203 TTTTTTATATAGCCATCGTAGGG + Intergenic
1098634699 12:72767860-72767882 TTTTGAGTATAGCAAATGTGAGG - Intergenic
1099671828 12:85703894-85703916 TTTTTATTGAAGCCACCGTGTGG + Intergenic
1100499510 12:95160336-95160358 TTTTTATTATAGCCATTGTGTGG - Intronic
1100742698 12:97612011-97612033 TTTTTATTAAAGACTCTGTGGGG - Intergenic
1100914280 12:99401063-99401085 TTTTTATGAAAGACATTGAGAGG + Intronic
1100989445 12:100236368-100236390 TTTCTATTATGACCATTCTGTGG + Intronic
1101250353 12:102928364-102928386 TTTTTAGTATTCTCATTGTGTGG + Intronic
1101255223 12:102970719-102970741 TTTTAATTTTAGCCTTTCTGGGG + Intergenic
1101918477 12:108914069-108914091 CTTTGATTTTAGCCGTTGTGTGG - Intronic
1102218907 12:111180957-111180979 ATTTTATGATACCCATTATGTGG - Intronic
1104347135 12:128010655-128010677 TTTGTTTAATATCCATTGTGAGG - Intergenic
1104516886 12:129435496-129435518 TTTTGATAATAACCATTCTGGGG + Intronic
1104612402 12:130240433-130240455 TTTTTATTATTTCAATTGTTTGG - Intergenic
1105399925 13:20082004-20082026 TTTTTTTTATAGTATTTGTGTGG + Exonic
1106758406 13:32844775-32844797 TTTTTATTACAGCCCTTCAGTGG + Intergenic
1107205170 13:37776558-37776580 TTTTTATTATACCCTGTTTGAGG - Intronic
1108380917 13:49853352-49853374 TTTTCAGCATAGCCTTTGTGTGG - Intergenic
1108806001 13:54157184-54157206 TTTTTAATATAGCCATTTTTGGG + Intergenic
1109301927 13:60598439-60598461 TTTTAATAATAGCCACTCTGGGG + Intergenic
1110571731 13:77011801-77011823 TTTTGATTATAGCCATGCTAGGG - Intronic
1110934831 13:81275114-81275136 TTGTTATAATAGCCATTTTAGGG - Intergenic
1111069907 13:83152206-83152228 CTTTTATTTTTGCCTTTGTGGGG + Intergenic
1111504480 13:89168974-89168996 TTTTTATCATTACCATTTTGGGG + Intergenic
1112374725 13:98828422-98828444 TTTTTATTATGGCCAATGTGTGG + Intronic
1112978270 13:105348302-105348324 TTTTTATTATTACCATTGCCTGG - Intergenic
1114008223 14:18336089-18336111 TATTTATAAAAGCCATTATGTGG - Intergenic
1114787065 14:25612815-25612837 TTTTAATAATAGCCATTCTGTGG + Intergenic
1116235274 14:42271893-42271915 TTTTTATTTTGGAAATTGTGGGG + Intergenic
1116397893 14:44469024-44469046 CTTTTATTATGCCCATGGTGAGG + Intergenic
1117436572 14:55720532-55720554 TGTATATTATAGCCATCCTGAGG + Intergenic
1117970967 14:61250540-61250562 TTTTTATTGTCTCCATTGTTTGG - Intronic
1118056883 14:62087947-62087969 TTTTCATTTTAGCCATGCTGGGG - Intronic
1118919991 14:70141314-70141336 ACATTATTATACCCATTGTGTGG + Intronic
1119463886 14:74837468-74837490 TTTTGATAATAGGCATTGGGTGG - Intronic
1120340838 14:83219251-83219273 TTTTTAATATAGTCATTTTGAGG - Intergenic
1121294332 14:92805655-92805677 TTTTAATTTTAGCCATTCTAGGG + Intronic
1124040577 15:26098745-26098767 TTTTAATGATCCCCATTGTGTGG + Intergenic
1126951564 15:53887353-53887375 ATTTTATTATAGGAAATGTGAGG + Intergenic
1127419952 15:58795306-58795328 TTTTCGTTATTGCCATTCTGAGG + Intronic
1127421834 15:58813874-58813896 TTTTTATTTTAGCCATTCTTAGG + Intronic
1128010413 15:64290025-64290047 TTTTAATAATAGCCATTCTTAGG - Intronic
1128785185 15:70390862-70390884 TTTTAATTTTAGCCATTCTAGGG - Intergenic
1128951385 15:71886764-71886786 TTGTCATTTTAGCAATTGTGGGG + Intronic
1130292826 15:82619748-82619770 CTTTCATTTTAGCCATTTTGGGG - Intronic
1130359674 15:83171208-83171230 TTTTAATAGTAGCCATTATGAGG - Intronic
1130810767 15:87376106-87376128 TTTTAAAAATAGCCATTCTGAGG - Intergenic
1131911118 15:97203419-97203441 TTTTTAATATAAACATTTTGAGG - Intergenic
1132940578 16:2505578-2505600 TTTTTATTACATTCATTGAGAGG - Intronic
1133147307 16:3798640-3798662 TTTTTATTATAGCCATGTGGTGG - Intronic
1133726670 16:8543780-8543802 TTTCTATCCTAGACATTGTGTGG - Intergenic
1133887522 16:9844450-9844472 TTCCTATTACAGCCCTTGTGTGG + Intronic
1134205492 16:12234221-12234243 TTTTTATTGTAGCCATCGAGTGG + Intronic
1134377223 16:13688419-13688441 TTTTTATTTTAGTTTTTGTGGGG + Intergenic
1135617286 16:23922415-23922437 TTTTTATTAAAGACATGGTATGG + Intronic
1137046774 16:35671837-35671859 TTTTTATTATAGGCCTTGATGGG - Intergenic
1137561923 16:49508104-49508126 TTCATATTAGAGGCATTGTGAGG + Intronic
1137626667 16:49913114-49913136 TTTTTTTTAAAGCCATTTAGTGG - Intergenic
1138920254 16:61519032-61519054 TTATTATTATAGACATTATGAGG + Intergenic
1139348269 16:66318717-66318739 TTTTTATTTTAGCCACTCTGGGG - Intergenic
1139503061 16:67384104-67384126 TTTTTCTTTTTGCCAGTGTGTGG + Intronic
1140846863 16:78897847-78897869 TTTTAATTATAGCCTTTTTGTGG + Intronic
1140859192 16:79004502-79004524 TTTCTATTATAGCCCTGGTGTGG + Intronic
1141074771 16:80994658-80994680 TTTTAAGTTCAGCCATTGTGTGG - Intronic
1141222690 16:82085935-82085957 TTTTTATTATAGCCATCTTAGGG - Intronic
1141947208 16:87318698-87318720 TTTTAATTTTAGCCATTCTTGGG - Intronic
1144592334 17:16535493-16535515 CATTTATTATTGCCAGTGTGTGG + Intergenic
1144613129 17:16742747-16742769 TTTTGATAGTAGCCATTCTGTGG + Intronic
1144899609 17:18572560-18572582 TTTTGATGGTAGCCATTCTGTGG - Intergenic
1145132789 17:20372826-20372848 TTTTGATAGTAGCCATTCTGTGG + Intergenic
1145221063 17:21088907-21088929 TTTTAATTTTAGCAATTTTGAGG - Intergenic
1148165441 17:45481086-45481108 TTTTTATTACAGCCATCCTAGGG + Intronic
1148976180 17:51531158-51531180 TTTTTATTGTAGCCATTAGTGGG + Intergenic
1149625370 17:58076439-58076461 TTTTTATTATACCCATCCTAGGG - Intergenic
1150076542 17:62197201-62197223 TTTTAATAATAGCTATTCTGCGG - Intergenic
1150195825 17:63298018-63298040 TTTTTATTACAGCCATCCTAGGG - Intronic
1150396669 17:64827802-64827824 TTTTTATTACAGCCATCCTAGGG + Intergenic
1150526455 17:65928241-65928263 TTTTTATTATTGCTATTCTTTGG - Intronic
1150908089 17:69359999-69360021 TTTTAATAATAGCCATTCTATGG - Intergenic
1151998905 17:77632447-77632469 TTTTTAATATATCAATTTTGGGG - Intergenic
1153056145 18:948654-948676 TTTTAATAATAGCCATTGAATGG + Intergenic
1154039417 18:10838957-10838979 TTTATATTATAGCTATTTAGGGG - Intronic
1155080390 18:22404280-22404302 TATTTATAATAGCCAATATGTGG - Intergenic
1155422856 18:25674257-25674279 TTTTTATTTTAGCCATTTTAGGG + Intergenic
1155467656 18:26156114-26156136 TTTTGATAATAGCCATTCTGAGG - Intronic
1155564283 18:27115819-27115841 TTTTTATTTTAGCCATTCCTAGG + Intronic
1155621940 18:27789260-27789282 TTTTTATTCTAGGAATTGTCTGG + Intergenic
1155924170 18:31636555-31636577 TTTTAATTTTAGCCATTTAGTGG - Intronic
1156358524 18:36363109-36363131 TTTTTATTTTAGCCATTCTAAGG - Intronic
1156419769 18:36938277-36938299 TTTTGGTAATAGCCATTCTGAGG + Intronic
1157191033 18:45581639-45581661 TTATTATTATATCCATTCTGAGG - Intronic
1157681505 18:49611080-49611102 TTTTTAATATATCCATTGTGGGG - Intergenic
1158042236 18:53109073-53109095 TTTTAATTTTAGCCATTTTATGG + Intronic
1158760175 18:60375487-60375509 TTTTTATTTTAGCCATCATAAGG + Intergenic
1159290880 18:66417822-66417844 TTTTAAATAAAGCTATTGTGTGG - Intergenic
1161799402 19:6407990-6408012 ATTTTATTTTGGACATTGTGAGG + Intergenic
1163308638 19:16498621-16498643 TTTTGATTATAGCCATGCTAGGG + Intronic
1164709057 19:30341723-30341745 TTTTGATTAATGCCATTTTGGGG - Intronic
1164887341 19:31792657-31792679 TTTTAATTGTAGCCATTCTAAGG - Intergenic
1165777713 19:38414631-38414653 CTTTTATTATTCCCATTTTGTGG + Intronic
1166246240 19:41528997-41529019 TTTTTGTAATTGCCATTGTTTGG + Intergenic
1167119891 19:47510604-47510626 TTTTTATTTTGGCTATTTTGGGG + Intronic
1167452094 19:49577077-49577099 TTTTGATTATAGTCATTCTAGGG - Intronic
924980573 2:216271-216293 TTTTCATTTTAGCCATTTAGAGG + Intergenic
925514030 2:4659382-4659404 TTTTTATTGTGGCCACTCTGTGG + Intergenic
926393948 2:12422749-12422771 TATTTATTATATGTATTGTGTGG - Intergenic
926789735 2:16557950-16557972 TTTTTACTGTATCCTTTGTGAGG - Intronic
926940250 2:18128318-18128340 TTTTCATTAAAGCCATTTTAAGG - Intronic
927051448 2:19333759-19333781 TTTCTATAAAAGCCATTGTTAGG + Intergenic
927158928 2:20240494-20240516 TTCTTCTTAAAGCCATTGTTGGG + Intergenic
927580110 2:24235826-24235848 CTTTTATTATAGCCATCCAGTGG - Intronic
927614902 2:24583365-24583387 TGTTGATAATAGCCATTCTGAGG - Intronic
927761929 2:25765183-25765205 TTTTGAAAATAGTCATTGTGTGG + Intronic
929101817 2:38322179-38322201 TTTTTTTTTTTGACATTGTGGGG - Intronic
929201006 2:39235789-39235811 GTAATATTATAGCAATTGTGGGG - Intergenic
929203326 2:39261454-39261476 TTTTAATTTTAGCCATTCGGTGG - Intronic
930573535 2:53116770-53116792 TTTTTATTATACCCATTTTACGG - Intergenic
930746345 2:54887011-54887033 TTTTTATTATTCCCATTATCTGG + Intronic
930757682 2:54994039-54994061 TTTTTATTAAAACCAATTTGAGG - Intronic
930757936 2:54997321-54997343 TTTTGATTATAGCCATCCTAGGG - Intronic
931674891 2:64684602-64684624 TTTTTATTTTAGCCTTTCTGAGG + Intronic
931698001 2:64886339-64886361 TTTTAATTATAGCCATCCTAAGG + Intergenic
933099857 2:78240546-78240568 TTTTTATTAGTGCTATTGTGAGG + Intergenic
933267273 2:80194965-80194987 TTTTCATTAAAGCCATTATTAGG - Intronic
935313505 2:101808131-101808153 TTTTTATTTTATCCATTAGGAGG + Intronic
936402978 2:112180307-112180329 TTTTAATAATAGCCATTCTGAGG - Intronic
937803555 2:126110125-126110147 TTTTTATTATAAACATCTTGTGG + Intergenic
938321020 2:130363956-130363978 TTTTAATTATAGCCATCCTAGGG + Intronic
938927776 2:136060313-136060335 TTTGTTTCATAGCCATCGTGTGG - Intergenic
939372318 2:141317247-141317269 TTTTTAAGATACCCAGTGTGTGG - Intronic
939511113 2:143105887-143105909 TTTTTCTTATTCCCATTGTTAGG + Intronic
939780604 2:146442400-146442422 TTTTTTTTAAAGATATTGTGAGG - Intergenic
940596541 2:155800712-155800734 TTTTTTTTAATGCCACTGTGAGG + Intergenic
941238244 2:163002865-163002887 TTATTATTGTAGTCATTCTGGGG + Intergenic
941298481 2:163771278-163771300 TTCTTATTATTTCCTTTGTGTGG + Intergenic
942705119 2:178762808-178762830 ATTTTATTATAGCCATAGAGAGG - Intronic
942985884 2:182141453-182141475 ATTGTATTATAGACATTATGAGG - Exonic
943415659 2:187599589-187599611 TTTTTTTTTTAGCCACTGTTTGG - Intergenic
943593830 2:189831447-189831469 TTTCTTTTATAGCTATTATGAGG + Intronic
943786797 2:191886252-191886274 TTCTGATTGAAGCCATTGTGAGG - Intergenic
943955714 2:194186791-194186813 CTTTGATAATAGCCATTCTGAGG + Intergenic
944395413 2:199260938-199260960 ATTATATTGAAGCCATTGTGAGG - Intergenic
944519013 2:200544860-200544882 TTTTCATTTTAGCCATTTTGAGG + Intronic
946095966 2:217274400-217274422 TTTTTATTATAACCCCTTTGAGG + Intergenic
946625563 2:221608939-221608961 TTTTGATTTTAGCCATCGTGGGG + Intergenic
949065635 2:241988648-241988670 TTTTTATTATTGTCATTATTTGG + Intergenic
1169099241 20:2931519-2931541 TTTTGATTTGAGCCTTTGTGTGG + Intronic
1169720345 20:8669252-8669274 TTTTGTTTATTGACATTGTGGGG + Intronic
1169974517 20:11309059-11309081 TTTTTATTATAGACAACCTGAGG - Intergenic
1169982045 20:11395545-11395567 TTATTAATATAGCTATTGAGTGG - Intergenic
1170487484 20:16833865-16833887 TTTTTTTTATATCCATTGTATGG - Intergenic
1170674232 20:18464451-18464473 TACTTCTTAGAGCCATTGTGAGG - Intronic
1171103448 20:22408718-22408740 TTTTGATAATAGCCATCCTGAGG - Intergenic
1171402298 20:24882483-24882505 TTTTTCTTTTATCCATTATGTGG - Intergenic
1172224883 20:33298932-33298954 TTGTTGTTATAGCCATTTTCGGG + Intronic
1172820574 20:37729821-37729843 TTTTTATTGTAGCCTGTCTGTGG + Intronic
1173002663 20:39115767-39115789 TTTTTATTACTGCTATTGTTAGG + Intergenic
1173312184 20:41906492-41906514 TTTTTAATTTAGCCATTTGGGGG + Intergenic
1173693608 20:44986566-44986588 TTTTAATTATAGCTTCTGTGTGG + Intronic
1174680135 20:52398696-52398718 TTTTTATTATGGCCATTCTTGGG - Intergenic
1175772954 20:61635314-61635336 TTTTTATAATAGCCATCCTAAGG + Intronic
1176359836 21:5985652-5985674 TCTTCATTGTAGCCATTCTGTGG + Intergenic
1178623447 21:34196350-34196372 TTGTTGTTATAGCCATTTTCAGG - Intergenic
1178898747 21:36582651-36582673 TTTTTATGATAGTCATTCTAGGG - Intergenic
1179386240 21:40945425-40945447 TTTTAATAATAGCCATTGACCGG - Intergenic
1179763682 21:43552898-43552920 TCTTCATTGTAGCCATTCTGTGG - Intronic
1180111344 21:45655446-45655468 TTTTGATTATAGCCATGTAGTGG + Intronic
1180432728 22:15266906-15266928 TATTTATAAAAGCCATTATGTGG - Intergenic
1181087564 22:20448887-20448909 TTTTTATTTTAGTCATCCTGAGG + Intronic
1183851558 22:40593261-40593283 TATTTATAATAGCCATTTAGAGG - Intronic
1183897396 22:40980316-40980338 TTTTGATAATAGCCATCCTGGGG + Intergenic
1184154634 22:42659237-42659259 TTTTGATTATAGCCATCTCGTGG + Intergenic
951385327 3:22034643-22034665 ATTTTATTATACCAATTATGAGG - Intronic
951659215 3:25043927-25043949 TTTCTATTAAAACCATTGAGAGG - Intergenic
952363777 3:32656895-32656917 CTTATGTTATAGCCATTGTATGG - Intergenic
952479055 3:33741410-33741432 TTTTGATAATAGCCATTCTAAGG + Intergenic
953043948 3:39278913-39278935 ATGTTGTTATAACCATTGTGAGG - Intronic
953755015 3:45638821-45638843 TTTTAATAATGGCCATTTTGTGG + Intronic
953813811 3:46136650-46136672 TTTTGATTATAGCCGTCCTGGGG + Intergenic
954529632 3:51307803-51307825 TTTTTTTTTTAGCCATTCTCTGG + Intronic
955622419 3:60878390-60878412 GTTTAATTATCCCCATTGTGAGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
955720749 3:61878273-61878295 TATTTACTATCGCTATTGTGTGG - Intronic
956012021 3:64842207-64842229 TTGTTATTATACTCATTGTACGG + Intergenic
956060871 3:65346845-65346867 TTTTTATTTTAGCAATGGGGAGG + Intergenic
956852536 3:73243528-73243550 TTTTGATTATAGCCATTCTAAGG - Intergenic
956869297 3:73401061-73401083 TTTTTCTTACACCCATTGTCAGG + Intronic
958680727 3:97328378-97328400 TTTTTATTTTAGCCATTAGTTGG + Intronic
959107520 3:102081341-102081363 TTTTAAAAATAGCCATTCTGTGG + Intergenic
959293615 3:104506291-104506313 TTTTGATAATAGCCATTTTAAGG + Intergenic
959502494 3:107122617-107122639 TTTTCATTACAGCCAGTGAGTGG + Intergenic
959561384 3:107787109-107787131 TTTTTATTATGGCCATCCTAAGG - Intronic
960098062 3:113707362-113707384 TTTTAATAATAGCCATTCTAGGG - Intergenic
960484204 3:118231204-118231226 TTACTAAAATAGCCATTGTGAGG + Intergenic
960678285 3:120219304-120219326 TTTATATTATAGCCATCTTAGGG + Intronic
960744748 3:120874720-120874742 GTATTATTATATCCATTGTGTGG - Intergenic
960811149 3:121628555-121628577 TTTTGATTGTTGCCACTGTGGGG - Exonic
961100433 3:124194195-124194217 CTTTTATTATACTCATTGTCTGG - Intronic
961987822 3:131156710-131156732 TTTTTTTTATAGTCATAGAGAGG - Intronic
962139802 3:132777403-132777425 TTTTTATTTTAGTCATTCTAAGG + Intergenic
963189812 3:142456745-142456767 TTTTTATTTTAGCCATTCTAGGG - Intronic
963202996 3:142603273-142603295 TTTTTATTATAGTAATATTGTGG + Intronic
963940168 3:151089425-151089447 TTTTTTTTTTTGCAATTGTGTGG + Intronic
964009008 3:151867102-151867124 TTTTTAGAATAGACATTGTTAGG + Intergenic
964070768 3:152630263-152630285 TTTTAATAATAGCCATTCTGAGG + Intergenic
965057170 3:163735725-163735747 TTTTTACTATTGCCATTTTTGGG - Intergenic
965241664 3:166208299-166208321 TTTTCATTATATCTTTTGTGTGG + Intergenic
965279207 3:166726686-166726708 TCTTTATTATAGCTATTGTTTGG + Intergenic
965630638 3:170729003-170729025 TCTCTATTATAGTCATTATGAGG - Intronic
965699605 3:171446697-171446719 TTTTGATTTTAGCAATTGTCTGG + Intronic
965859155 3:173126115-173126137 TTTTTATTGTAGTCTTTGTTAGG + Intronic
966120846 3:176518149-176518171 TTTTTAATTTAACCATTTTGAGG - Intergenic
967819090 3:193824785-193824807 TTTTGATTTTAGCCATTCTAAGG + Intergenic
970082839 4:12307992-12308014 TTTTTATTATAGCCATGTAGTGG + Intergenic
970332026 4:14996364-14996386 TTATTATTATATCTATTTTGGGG + Intergenic
970416212 4:15859669-15859691 TTTTAATAATACCCATTCTGAGG - Intergenic
970771438 4:19617123-19617145 TTTTTATTATTGTCATTTGGTGG - Intergenic
970883508 4:20959985-20960007 TTTTTAATATCACCATTGTCTGG + Intronic
971227493 4:24768622-24768644 TTATTATTATTTCCATTTTGTGG - Intergenic
971891946 4:32535913-32535935 TTTTTATTATAGACATCCTAGGG - Intergenic
972104479 4:35464187-35464209 TTTTTACAATAGCCATTATCAGG + Intergenic
974656264 4:64826654-64826676 TTATTATTATAGGCATTATAGGG - Intergenic
974784569 4:66601617-66601639 TTTTGATAATAGTCATTCTGAGG - Intergenic
974890186 4:67872210-67872232 ATTTTATTTTGGCCATTTTGGGG - Intronic
975200232 4:71578968-71578990 TTTCGATAATAGCCATTGTATGG - Intergenic
975535889 4:75449873-75449895 TTTTTATTTTAGCCATTCTGAGG - Intergenic
975575939 4:75862588-75862610 TTTTTATTATACCCATTCTGCGG - Intronic
975885595 4:78960918-78960940 TTTTTGTTATACTCAGTGTGAGG + Intergenic
975932481 4:79542023-79542045 TTTAAATTTTAGCCATTCTGGGG + Intergenic
976028172 4:80717157-80717179 TTTTTTTCATAGTTATTGTGTGG - Intronic
976538818 4:86249210-86249232 TATTTATTTTAGCCACTGTTAGG - Intronic
976551386 4:86399570-86399592 TTTATATTATGACCATTTTGAGG + Intronic
976762112 4:88560265-88560287 TTTTTATAATAGCCATCCTAAGG + Intronic
977016895 4:91701943-91701965 TTTTTTTTATGGCCAGTGTTGGG + Intergenic
977063604 4:92286664-92286686 TTTTTATAATAGCCCTTCTAAGG + Intergenic
977066026 4:92316539-92316561 TTTTTTTTACACCTATTGTGTGG + Intronic
977540048 4:98306209-98306231 TTTGTAATATAGCCGGTGTGTGG - Intronic
978010936 4:103683103-103683125 TTTTTCTTTGATCCATTGTGTGG - Intronic
978118952 4:105055247-105055269 TTCTAATAATAGCCATTGAGTGG - Intergenic
978171026 4:105670314-105670336 TTTTAATTATAGCCATCTTGTGG + Intronic
979205750 4:118035120-118035142 TATTTAATATATCCATTTTGTGG + Intronic
979489157 4:121305573-121305595 TTTTTATACCAGCCATTCTGAGG - Intergenic
979756547 4:124347425-124347447 TTTTAATTTTAGTCATTTTGTGG - Intergenic
981564539 4:146085307-146085329 TTTTAAAAATAGCCATTGTGAGG - Intergenic
982045321 4:151439367-151439389 TTTTTATTATTGCTATTATGTGG + Intronic
982549731 4:156782900-156782922 TGAATAATATAGCCATTGTGAGG + Intronic
982876026 4:160650989-160651011 GTTTTACTATTGCAATTGTGGGG + Intergenic
983594736 4:169453461-169453483 TTTTGATTATAGCCAGTTTTGGG - Intronic
983829426 4:172306471-172306493 TTTTAATTATTTCCATTGTTTGG + Intronic
983983598 4:174029721-174029743 TTTATCTTATAGCCATATTGTGG + Intergenic
984374202 4:178906193-178906215 TTTTTATTAGAGCCAAGGTGAGG + Intergenic
985070769 4:186164840-186164862 TTTTTATTATTGCCACCCTGAGG + Intronic
986629955 5:9762118-9762140 CTTTTATTATTACCAGTGTGAGG - Intergenic
986774328 5:11000220-11000242 TTCTTATTCTAGAAATTGTGTGG + Intronic
988163221 5:27548443-27548465 TTTTAATAACAGCCATTGTGAGG - Intergenic
988462410 5:31451929-31451951 TATTTATTATTCTCATTGTGCGG - Intronic
988655118 5:33202472-33202494 TATTTATTATAGCCATAAAGTGG - Intergenic
989711327 5:44400802-44400824 TTTTTACTATTGCCATTAAGTGG - Intergenic
989988419 5:50731544-50731566 TTTTTGTTATTTCCATTGTAAGG + Intronic
989997685 5:50855165-50855187 TTTTTAATATAGACATTTTTCGG - Intergenic
990096140 5:52116261-52116283 TTTTTATTATATTCATTCTTTGG - Intergenic
990343090 5:54844275-54844297 ATTTTATTATAGCCTTTCTGTGG - Intergenic
990403444 5:55464091-55464113 TTGTTATTTTAGCCATTCTAAGG - Intronic
990769981 5:59232485-59232507 TTTTAATAATAGCCATTCTAAGG - Intronic
990983794 5:61623799-61623821 TTTTTCCTATACCCATTGCGGGG + Intergenic
992591850 5:78303737-78303759 GGTTTATTTTAGGCATTGTGTGG - Intergenic
992935641 5:81701360-81701382 TTATTATTATATCTATTATGAGG - Intronic
993262047 5:85670037-85670059 TTTTTATTAGAGAAATTCTGTGG + Intergenic
993445188 5:88003213-88003235 TTTTGATTATGGCCATTCTTGGG + Intergenic
993571574 5:89546426-89546448 GTTTTATTAAAGTCATTGTTTGG - Intergenic
994305887 5:98203768-98203790 TTTTGTTTATAGCCAGTTTGGGG - Intergenic
994562366 5:101392092-101392114 TTTTTATGAAAACCATTTTGGGG - Intergenic
994563511 5:101409592-101409614 TTTTAATTATGGCCATTCTTGGG - Intergenic
994598881 5:101876286-101876308 TTTTTAATATAGTCATACTGGGG - Intergenic
996490890 5:124094695-124094717 TTTTGACTATGGCCATTCTGTGG + Intergenic
997125108 5:131218358-131218380 TTGTTATTTTAGTCATTTTGGGG - Intergenic
997883335 5:137610115-137610137 TTTTTATTACAGCCATCCTAGGG + Intergenic
998479247 5:142448128-142448150 TTTACATTTTAGCCATTGAGGGG + Intergenic
999469965 5:151845539-151845561 TTTTAACTATAGCCATTTAGTGG - Intronic
999630493 5:153566151-153566173 TTTTCATTATAGTCATTCTGTGG + Intronic
1000026806 5:157366132-157366154 CTTTAATCATAGCCATTCTGGGG + Intronic
1000091850 5:157936550-157936572 TTTTAATTGTAGCCATTCTAAGG + Intergenic
1000490620 5:161908435-161908457 ATTTGATTATAGCCATTCTATGG - Intergenic
1000703042 5:164476865-164476887 TTTTTCCTAAAGCTATTGTGAGG + Intergenic
1000979831 5:167804869-167804891 TTTTTATTCCTGCCATTTTGGGG - Intronic
1001853114 5:174986735-174986757 TGATTATTATAGCCACTATGGGG + Intergenic
1004132829 6:12937238-12937260 TTTTTATTATTGTCTTTGTGTGG - Intronic
1004132961 6:12938446-12938468 TTGTTATTATTGTCATCGTGTGG - Intronic
1005457550 6:26035352-26035374 ATATTATTACAGCCATTGTCTGG + Intergenic
1005593590 6:27354346-27354368 TATTTATAATAGCAATTCTGAGG - Intergenic
1005880134 6:30050784-30050806 TTTTGATTCTAGCCATTCTTTGG - Intergenic
1006978204 6:38123575-38123597 TTATCATTATTGCCATTGTGTGG + Intronic
1008141361 6:47836170-47836192 TTTCTATTTTAGATATTGTGAGG - Intergenic
1008314092 6:50017801-50017823 TTTTTATTATGGCCTCTCTGTGG - Intronic
1009030534 6:58052154-58052176 TTTTGATAATAGTCATTCTGAGG + Intergenic
1009206071 6:60803317-60803339 TTTTGATAATAGTCATTCTGAGG + Intergenic
1010600500 6:77820015-77820037 TTTTTATTATAAGCTTTCTGAGG + Intronic
1011091803 6:83611206-83611228 TTTTTATTACAGCCATGGGGGGG - Intronic
1011930933 6:92711726-92711748 TTTTTATTATCTCCATTGATTGG - Intergenic
1011958200 6:93051413-93051435 TTAAAATTATAGCCTTTGTGAGG - Intergenic
1014793163 6:125697989-125698011 TTTTGATTATAGCCATCTAGTGG - Intergenic
1015120045 6:129691693-129691715 TTTTGTTTATTGCCATTGTTGGG - Intronic
1015837565 6:137437697-137437719 TTTTGATAATAGCCATTCTAAGG + Intergenic
1016644844 6:146394717-146394739 ATTGTATTTTAGCCATTGTGAGG + Intronic
1017576678 6:155813126-155813148 TTTTTATTTTAGCATTTGAGAGG + Intergenic
1018003622 6:159600974-159600996 TTTTTATTATGGCCATGGGTGGG - Intergenic
1018263591 6:161995718-161995740 TTTTGATAATAGCCATACTGAGG - Intronic
1018366503 6:163125536-163125558 TTTTTCTTATAGCTATTTAGGGG - Intronic
1020437477 7:8180663-8180685 TTTAAATTTTAGCCATTGGGTGG + Intronic
1020947653 7:14633728-14633750 TTTTTATTTAATCCAATGTGAGG + Intronic
1021471691 7:21010072-21010094 TTTTGATTGTAGCCATTCTCAGG - Intergenic
1021510992 7:21432530-21432552 TTTTTCCCTTAGCCATTGTGAGG + Intronic
1021807226 7:24369393-24369415 TTTTTCTTATAACCAGTGTCAGG - Intergenic
1021971654 7:25970976-25970998 TTTTTATTGTAGTCTTAGTGAGG - Intergenic
1022883331 7:34613705-34613727 TTTTTGTTAAAGCCTTTGTCTGG - Intergenic
1023066962 7:36388287-36388309 TTTTTTTTTTAACCTTTGTGGGG - Intronic
1023211912 7:37815113-37815135 TTTTAATAATAGCCATTCTCGGG - Intronic
1023467450 7:40472639-40472661 TTATTATTATTGGCATTATGTGG - Intronic
1023664593 7:42509750-42509772 TTTTTATTTTAGCCATTTCATGG - Intergenic
1024108959 7:46125562-46125584 TTTTAATTTTAGCCATTCTAAGG - Intergenic
1024166069 7:46731853-46731875 TTATGATTATAGTCATTTTGGGG + Intronic
1024204104 7:47140150-47140172 TTTTTATATTAGCCATTCTATGG - Intergenic
1024223992 7:47311243-47311265 TTTTAATGATTGCCATTCTGGGG + Intronic
1026021489 7:66710559-66710581 TTTTAATTTTAGCCATTCTAAGG + Intronic
1026157723 7:67841739-67841761 TTTTAATAACAGCCATTCTGGGG - Intergenic
1026401493 7:70018487-70018509 AATTTACTATAGCCATTCTGAGG + Intronic
1026885953 7:73945500-73945522 TTTTAATTTTAGCCATTCTAAGG + Intergenic
1027460313 7:78444020-78444042 TTTTTCTTAAGGCCATTTTGTGG + Intronic
1027526412 7:79274884-79274906 TTATTATTATAATCATTTTGGGG + Intronic
1028210269 7:88065461-88065483 TGTTTATTATAGACATTTTAAGG + Intronic
1028346156 7:89785707-89785729 TTTTTAATATAGCCATTCTATGG - Intergenic
1028628615 7:92906684-92906706 TTTTAATTTTAGCCATTCTACGG + Intergenic
1028756258 7:94438094-94438116 TTTTTATTATCACTTTTGTGAGG + Intergenic
1030886217 7:114941337-114941359 GTTTGATTAGAGACATTGTGTGG - Intronic
1031232680 7:119129564-119129586 TGTTTATTAGATCTATTGTGGGG + Intergenic
1031779516 7:125943467-125943489 TTTTGATTATAGCCATTTTTGGG - Intergenic
1033386838 7:140885301-140885323 TTTTTTTTAAAGCCACTTTGGGG - Intronic
1034340705 7:150352940-150352962 TTTAAATTATAGCCTTTGTTGGG + Intergenic
1035005819 7:155659747-155659769 GTTTTAATATATCCAGTGTGTGG - Intronic
1036147253 8:6265543-6265565 TTTTAATTATAGGCATTTTCTGG - Intergenic
1036836815 8:12077545-12077567 TTTCTATTAAAGCCAATGTCTGG - Intergenic
1036858605 8:12323789-12323811 TTTCTATTAAAGCCAATGTCTGG - Intergenic
1037273419 8:17154594-17154616 TTTTTGTTATTGCCATTTTAAGG - Intergenic
1038671692 8:29588228-29588250 CTCTTATTATGGCCATTCTGCGG - Intergenic
1038771645 8:30487947-30487969 TTTTTTTCTTGGCCATTGTGCGG + Intronic
1039654457 8:39386524-39386546 TTTTAAGAATAGCCATTCTGAGG + Intergenic
1040409058 8:47136315-47136337 TTTTAATAATAGCCATTCTGAGG + Intergenic
1040441637 8:47449403-47449425 TTTTTAGTATAACCCATGTGTGG + Intronic
1040921019 8:52617278-52617300 CTATTCTTATAGCCTTTGTGAGG - Intergenic
1041516682 8:58707409-58707431 TTTTTAATCTAGCCATTCTGAGG - Intergenic
1041571396 8:59341165-59341187 TTTTTATTATAGCCTTTCTCTGG - Intergenic
1041880500 8:62744301-62744323 ATTTTAATATAGTCATTGTGAGG + Intronic
1042015891 8:64310724-64310746 TTTTAATAGTAGCCATTCTGCGG - Intergenic
1042139490 8:65663615-65663637 TTTTTATTTTAGCAATTCTAGGG - Intronic
1042202541 8:66293208-66293230 TTTTTATTATTTCCAATTTGGGG + Intergenic
1042578987 8:70255732-70255754 TATTGATTATAGTGATTGTGTGG - Intronic
1042981515 8:74534564-74534586 TTTTTCCTATAACTATTGTGTGG - Intergenic
1043060808 8:75500333-75500355 TTTTCATTATAGCCATTGTGGGG - Intronic
1043368737 8:79565871-79565893 TTTTTCAAATAGCCATTGAGGGG - Intergenic
1043790541 8:84462135-84462157 TTTTTATTTTAGCCATTCTAAGG + Intronic
1044026699 8:87181823-87181845 TTTCTAATATAGGCATTTTGTGG + Intronic
1044230698 8:89774359-89774381 CTTTAATTATAGCTATTTTGTGG - Intronic
1044278762 8:90333223-90333245 TCTTTGAAATAGCCATTGTGGGG + Intergenic
1045555947 8:103214680-103214702 TTTGTATTATTTCCATTGTGTGG - Intronic
1046277085 8:111976871-111976893 TGTTAATTTTAGCCATTTTGTGG + Intergenic
1047095378 8:121619394-121619416 GTTTAATTATAGCAATTTTGGGG + Intronic
1047273699 8:123388693-123388715 TTTTTATTTTAGAGATGGTGGGG + Intronic
1047582732 8:126234387-126234409 TTTTTATGACAGCAATTTTGAGG - Intergenic
1047986420 8:130239374-130239396 TTCTTATTATATCCATTTTATGG + Intronic
1048101339 8:131355399-131355421 TTTTAATTATAGCCATTCTGAGG + Intergenic
1050050089 9:1590583-1590605 ATTTTATTATAGCCAGTCTAGGG - Intergenic
1050087694 9:1983533-1983555 TATTTAGTATTGCCATTGAGAGG + Intergenic
1050127356 9:2372212-2372234 TTTCTTTTTCAGCCATTGTGTGG - Intergenic
1050171078 9:2817433-2817455 TAATTATTTTAGCCTTTGTGGGG - Intronic
1050995896 9:12217174-12217196 TCTTAATTTTAGCCATTGTAGGG + Intergenic
1051197838 9:14582927-14582949 CTTTGATGGTAGCCATTGTGAGG - Intergenic
1051531354 9:18107555-18107577 TTTTTTTTATAGCCATGCTCTGG + Intergenic
1051573595 9:18588148-18588170 TTTTAATAATAGCCACTCTGAGG + Intronic
1051756619 9:20407752-20407774 TTATTATTATTGCCATTTTATGG - Intronic
1054795415 9:69296905-69296927 TTTTTATTCTAATGATTGTGTGG - Intergenic
1054801136 9:69349452-69349474 TTTTGATTGTAGCCATTCTTTGG + Intronic
1055806583 9:80102046-80102068 TTTTTACTATAGCCATCTAGTGG + Intergenic
1056039452 9:82647274-82647296 TTTTTATGATATCCATTGACTGG + Intergenic
1056489785 9:87094332-87094354 TTTTAATAATAGCCATTGACTGG + Intergenic
1057005921 9:91559039-91559061 TTTTTATTGTAGCCATCTAGTGG + Intergenic
1057224443 9:93282676-93282698 TTTTTATTTTATGCATTTTGAGG - Intronic
1057533914 9:95879313-95879335 TTCATTTTATACCCATTGTGTGG + Intronic
1058397173 9:104567962-104567984 TTTTTTTTTTGGCCTTTGTGGGG + Intergenic
1058806057 9:108593327-108593349 TTTGTGTTTTTGCCATTGTGGGG - Intergenic
1059577358 9:115504844-115504866 TTTTTATTATATATATTTTGAGG - Intergenic
1060074127 9:120576749-120576771 TTTTGATTATAGCCATCCTTTGG - Intronic
1060572359 9:124654107-124654129 TTTCTTTTATAACCATTTTGGGG - Intronic
1061722245 9:132559495-132559517 TTTTTATTCTAGCCGTTGTAGGG - Intronic
1061788033 9:133042553-133042575 TTTTTAATGAAACCATTGTGTGG + Intronic
1185692252 X:2165201-2165223 TTTTGATTATGGCCATTCTTCGG - Intergenic
1186208667 X:7226974-7226996 TTTTTATTTTAGCCACCGTAGGG + Intronic
1187309593 X:18129088-18129110 TTTTTATTATAGAAAATGTGGGG - Intergenic
1187926680 X:24257211-24257233 TTTTATTTTTAGCCATTCTGGGG + Intergenic
1190896755 X:54626694-54626716 TTTTGAAAATAGCCATTCTGAGG + Intergenic
1190994263 X:55590544-55590566 TTTTAACTATAGGCATAGTGAGG - Intergenic
1192536322 X:71931075-71931097 TTTTTATTATAGCCATCCTAGGG + Intergenic
1193054067 X:77131260-77131282 TTTTATTAATAGCCATTCTGAGG - Intergenic
1193761744 X:85475638-85475660 CTTTTCCTATAGCCATTTTGAGG - Intergenic
1193995244 X:88358768-88358790 TCTATATCTTAGCCATTGTGAGG - Intergenic
1194035648 X:88868133-88868155 TTTGTATTCTAGCCAGTGGGAGG + Intergenic
1194987887 X:100511013-100511035 TATTGATTATTGCCGTTGTGAGG - Intergenic
1195019687 X:100814514-100814536 TTTTTATAATAGCCATCCTAGGG - Intergenic
1195246191 X:102997625-102997647 CTTTTATTATAACAATTATGAGG - Intergenic
1195640496 X:107169515-107169537 TCTTTATGTTAGCCCTTGTGAGG + Intronic
1195748673 X:108143499-108143521 TTTTTCTTACCTCCATTGTGGGG + Intronic
1195783315 X:108487473-108487495 TTTTAATTATGGCCATTCTTGGG + Intronic
1196169608 X:112573291-112573313 TCTTTATTTTAGCCATTTGGTGG - Intergenic
1196317205 X:114242098-114242120 ATTTTATTATATGCATGGTGGGG + Intergenic
1196336599 X:114543470-114543492 TTTTAATTATCGCCATTCTATGG + Intergenic
1196637898 X:118024698-118024720 CTTTAATTTTAGCCATTCTGTGG - Intronic
1196724195 X:118881281-118881303 TTTTGATTATAGCCATACTAGGG + Intergenic
1196861184 X:120028559-120028581 TTCTTATTATAGCCATCTAGTGG - Intergenic
1197007834 X:121524207-121524229 ATTTTACTATGGCCATTTTGAGG + Intergenic
1197234415 X:124043304-124043326 TTTTTAGTAGAGACATGGTGGGG + Intronic
1197348084 X:125348782-125348804 TTTTCATCATAGTCATTCTGGGG - Intergenic
1198473752 X:136975405-136975427 TTTTTATTATAGCCACCTAGTGG + Intergenic
1199612896 X:149632537-149632559 TTTTTATCATTTCCATTCTGCGG - Intergenic
1200885563 Y:8265240-8265262 TTTTTATGATGGCTATGGTGAGG - Intergenic
1202110745 Y:21416287-21416309 TAATAATTATAGCTATTGTGAGG - Intergenic