ID: 1100499731

View in Genome Browser
Species Human (GRCh38)
Location 12:95162225-95162247
Sequence AAGAATAGCCCCAGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100499728_1100499731 12 Left 1100499728 12:95162190-95162212 CCAGGAGTTCAAGGCTGCAGGGG 0: 5
1: 148
2: 3578
3: 12551
4: 25879
Right 1100499731 12:95162225-95162247 AAGAATAGCCCCAGTTGGCCAGG 0: 1
1: 0
2: 4
3: 24
4: 219
1100499726_1100499731 13 Left 1100499726 12:95162189-95162211 CCCAGGAGTTCAAGGCTGCAGGG 0: 55
1: 2923
2: 10748
3: 25168
4: 40307
Right 1100499731 12:95162225-95162247 AAGAATAGCCCCAGTTGGCCAGG 0: 1
1: 0
2: 4
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100499731 Original CRISPR AAGAATAGCCCCAGTTGGCC AGG Intronic
900606800 1:3527375-3527397 ACGAACAGCCCCAGGAGGCCAGG + Intronic
901166777 1:7227126-7227148 AAAAATGGCTTCAGTTGGCCGGG - Intronic
901393516 1:8963834-8963856 AAAAATAATACCAGTTGGCCAGG - Intronic
902546073 1:17191055-17191077 AAGAATAACCACACCTGGCCGGG + Intergenic
907210476 1:52817095-52817117 AAGAATACCTTAAGTTGGCCGGG - Intronic
907936247 1:59044771-59044793 AAGAATCCCTGCAGTTGGCCAGG - Intergenic
908070614 1:60455525-60455547 GAGGATAGGCCCAGTGGGCCTGG + Intergenic
908452320 1:64268370-64268392 AAAAATTACCCCAGCTGGCCAGG + Intergenic
908709703 1:67001423-67001445 TGGAATAACCCTAGTTGGCCAGG - Exonic
909057548 1:70839956-70839978 TAGTAAAGCCCCTGTTGGCCTGG - Intergenic
909714073 1:78686375-78686397 AAAAATACACCAAGTTGGCCTGG + Intergenic
910654385 1:89605136-89605158 AAGTATAGTACCAGTTGCCCTGG - Intergenic
910932630 1:92457703-92457725 AAGAATGGCCACAGAGGGCCAGG - Intergenic
911715526 1:101128217-101128239 AAGAATAGCCACAGTAAGCCTGG + Intergenic
914492181 1:148159504-148159526 TAGAAGAGCCGCAGTAGGCCGGG + Intergenic
914672299 1:149880484-149880506 AAGAGTAGCCACTATTGGCCGGG + Intronic
916063682 1:161119367-161119389 AAGAATACACCCAGCTTGCCAGG + Exonic
916597072 1:166254044-166254066 AAGTATAACCCCTGTTGGTCAGG - Intergenic
917184066 1:172332602-172332624 GAGAAAAGCCCCAGCTGGCCGGG - Intronic
919977209 1:202620385-202620407 GAGAACAGCCACACTTGGCCTGG + Intronic
921018748 1:211216601-211216623 AAAAATAGTCCAGGTTGGCCGGG - Intergenic
921946144 1:220887339-220887361 AAGGGTAGCCACAGGTGGCCAGG + Intergenic
924115739 1:240744633-240744655 AAAAATTGCACAAGTTGGCCAGG + Intergenic
1065777067 10:29130885-29130907 AAGAATTGCCCCAGTTGTTCTGG + Intergenic
1068512285 10:57982045-57982067 AAGAATAGACCCAGGAGACCTGG - Intergenic
1070584127 10:77748202-77748224 AAGAACAGCTCCAGGAGGCCGGG + Intergenic
1072188281 10:93061870-93061892 AACAAGATCCCCAGTGGGCCTGG - Intronic
1072781384 10:98254029-98254051 AAGAATGAACCCAGGTGGCCTGG - Intronic
1072810783 10:98459800-98459822 AAGCCTAGCCCCAGATGGCCTGG + Intronic
1073026990 10:100495119-100495141 AAAAATAGCTACAGTAGGCCTGG - Intronic
1073182414 10:101592718-101592740 AAAAAAAGCCTCAGTTGGCCGGG + Intronic
1074413441 10:113247070-113247092 AAGACTGAACCCAGTTGGCCAGG - Intergenic
1075118323 10:119645870-119645892 AAGAATAAGTACAGTTGGCCAGG - Intergenic
1075756717 10:124818099-124818121 AAGAATAGACTTAGTTGGCCGGG + Intronic
1076013327 10:127007538-127007560 AAGAATAACCCCAGATGGCCCGG - Intronic
1076046039 10:127294935-127294957 AAGAATAGGACAACTTGGCCAGG - Intronic
1080447482 11:32351034-32351056 AAAAGTAGCTCCATTTGGCCGGG + Intergenic
1082836049 11:57650741-57650763 AAGAAGAGCCCAAAGTGGCCAGG - Intronic
1082918495 11:58465692-58465714 AAGAAAAGTCCCACTTGACCTGG - Intergenic
1083227966 11:61296319-61296341 AAGAAAAACCACAGGTGGCCGGG + Intergenic
1083740547 11:64708894-64708916 AAAAATGTCCTCAGTTGGCCAGG + Intronic
1083948440 11:65939864-65939886 AAAAATGGCCCAAGCTGGCCGGG + Intergenic
1086399921 11:86452267-86452289 ATGAAGAGCCCCAGCTGGCCAGG - Intronic
1087247030 11:95851336-95851358 AAGAATAGGAACATTTGGCCAGG - Intronic
1087323231 11:96687906-96687928 AAAAGTAGCTCCAGATGGCCGGG + Intergenic
1088487811 11:110357917-110357939 CAGAATAGCCTATGTTGGCCGGG + Intergenic
1090356202 11:126141964-126141986 AGAAATAGCCCCCCTTGGCCAGG + Intergenic
1092266628 12:6986068-6986090 AAAAAAAACACCAGTTGGCCGGG - Intronic
1093456747 12:19372283-19372305 AAGAATGGCCATAATTGGCCGGG - Intronic
1093665043 12:21802634-21802656 AATAATAGCCACATGTGGCCAGG + Intronic
1093799157 12:23351109-23351131 CAGAATAACCCAAGTTGGTCAGG + Intergenic
1094181026 12:27592842-27592864 AAAAATAGCCCAAGTAGGCTGGG + Intronic
1094214248 12:27923522-27923544 AAAAATACCCACGGTTGGCCAGG - Intergenic
1095471085 12:42537458-42537480 AAGAATAGTCTCAGATGACCAGG - Intronic
1096324561 12:50647817-50647839 AAGAATAGGAGCAGCTGGCCGGG + Intronic
1099308466 12:80988160-80988182 AAGAAAAAACACAGTTGGCCAGG + Intronic
1099557189 12:84124656-84124678 AAAAATAAGCCCTGTTGGCCGGG + Intergenic
1100499731 12:95162225-95162247 AAGAATAGCCCCAGTTGGCCAGG + Intronic
1103672920 12:122632984-122633006 AAAAATATCCCCAGGTGGGCCGG - Intergenic
1104694941 12:130856060-130856082 AAGAATAGGCACAGTTGGCTGGG - Intergenic
1105466015 13:20640848-20640870 AAAAAAATCCTCAGTTGGCCGGG + Intronic
1105589599 13:21779069-21779091 AAAAATGGCCCCAATAGGCCGGG - Intergenic
1106296097 13:28415181-28415203 AATAATAGCACCACTTTGCCCGG + Intronic
1107120113 13:36787045-36787067 AAGAACAGTCGGAGTTGGCCAGG + Intergenic
1108372206 13:49781165-49781187 AAGAATCACCTGAGTTGGCCTGG - Intronic
1110270688 13:73586657-73586679 AAAAATAGCCAGAGATGGCCGGG + Intergenic
1112316246 13:98364308-98364330 TATAATAGCCAAAGTTGGCCAGG - Intronic
1115988460 14:39127057-39127079 AAAAATACCATCAGTTGGCCAGG - Intronic
1116078840 14:40147042-40147064 GATCACAGCCCCAGTTGGCCTGG + Intergenic
1116295111 14:43097734-43097756 AAGAATACCTCCAGCTGGCCAGG - Intergenic
1117840100 14:59851562-59851584 AAGAATAAACCAATTTGGCCAGG + Intronic
1119430428 14:74564676-74564698 AATTATAGCACCAGTTGGCTGGG - Intronic
1123506932 15:20951806-20951828 AAGACTAGCAGAAGTTGGCCAGG + Intergenic
1123564160 15:21525561-21525583 AAGACTAGCAGAAGTTGGCCAGG + Intergenic
1123600414 15:21962845-21962867 AAGACTAGCAGAAGTTGGCCAGG + Intergenic
1124343921 15:28908602-28908624 AACAATAACCTCAGTGGGCCTGG - Intronic
1124492872 15:30168769-30168791 GAGAACAGCCACATTTGGCCTGG + Intergenic
1124562415 15:30787406-30787428 AAGAGTAGCCCCAGTAGGGTAGG + Intergenic
1124750662 15:32369556-32369578 GAGAACAGCCACATTTGGCCTGG - Intergenic
1126793056 15:52238339-52238361 AAAAATAGCCGCAGCCGGCCAGG - Intronic
1127987969 15:64089548-64089570 AAGAAGAACCCTAGTTTGCCTGG + Intronic
1128292309 15:66487341-66487363 AAGAAAACACCCAGGTGGCCGGG + Intronic
1128968716 15:72087058-72087080 TAGAATAGCTCCTGTGGGCCGGG - Intronic
1132211220 15:100023814-100023836 GAGAATAGCCCAAGATGCCCTGG - Intronic
1202972520 15_KI270727v1_random:252657-252679 AAGACTAGCAGAAGTTGGCCAGG + Intergenic
1133301271 16:4784166-4784188 ACGAATCGTCCCGGTTGGCCCGG + Intronic
1135655552 16:24245517-24245539 CTGTATAGCCCTAGTTGGCCAGG - Intergenic
1136058531 16:27708764-27708786 ACGAGTTGCCCCAGTTGGACAGG - Exonic
1137440340 16:48493533-48493555 TAAAATAGCCTAAGTTGGCCAGG + Intergenic
1137911134 16:52379702-52379724 AGAAATAGCCACTGTTGGCCAGG + Intergenic
1139640621 16:68288985-68289007 AAGAATTGCCCTTGTTGGGCTGG + Intronic
1139843054 16:69897612-69897634 AAGAATGGCTGCAGTAGGCCAGG + Intronic
1140535547 16:75705899-75705921 AAGTATACCTCCAGATGGCCTGG - Intronic
1142874978 17:2846569-2846591 CAAAATAGCCAAAGTTGGCCAGG - Intronic
1143997201 17:11017150-11017172 AAGCATGGCCCCTGTTGGCCAGG - Intergenic
1144016620 17:11202168-11202190 AAAAATGCCTCCAGTTGGCCGGG - Intergenic
1145039978 17:19570577-19570599 ACGATTGGCCCCAGATGGCCAGG - Intronic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146359675 17:32163859-32163881 AAGAATAGTGCCTGGTGGCCAGG + Intronic
1148922900 17:51054729-51054751 AAAAATACCCACATTTGGCCAGG - Intronic
1149226230 17:54474183-54474205 AAAAATAGCCAGAGTAGGCCAGG - Intergenic
1149922160 17:60670123-60670145 AAGAATGACCACACTTGGCCTGG + Intergenic
1150761635 17:67967435-67967457 AAGAATATGCACAATTGGCCGGG - Intronic
1151513816 17:74579484-74579506 GGGAATAGCCCCAGGTGGCACGG + Exonic
1152015777 17:77749450-77749472 AGGAAAAGCCCCAGATGGCCTGG - Intergenic
1152652029 17:81499279-81499301 AAGAGGAGCCGCAGATGGCCGGG - Intergenic
1153281020 18:3414486-3414508 AAGTCTAGCCCCAGTTGGGTTGG + Intronic
1153840160 18:9000143-9000165 AAGCATAGCTCCAGTGGGCACGG - Intergenic
1154157345 18:11954069-11954091 AAAAATAGCCTAGGTTGGCCGGG - Intergenic
1154944245 18:21146050-21146072 AAGAATGGCCCCAGTGTGCATGG - Intergenic
1155051342 18:22150360-22150382 AAGAATACCATCACTTGGCCAGG - Intergenic
1156064690 18:33126076-33126098 AGGAATAGCTCCAGGTGGACAGG + Intronic
1156514446 18:37668352-37668374 AAGAATAGTCCCAGTGGTGCTGG + Intergenic
1157829640 18:50845425-50845447 AAGAATAGAACCAGATGGCCGGG + Intergenic
1159188287 18:65007720-65007742 CAGAATAGCCCAAATTGGCCAGG - Intergenic
1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG + Intergenic
1161769664 19:6224319-6224341 CAGAATCCCCCCAGCTGGCCTGG + Intronic
1162137891 19:8567358-8567380 AAAAATAGACCCAGTGGGCCGGG - Intronic
1162294254 19:9802230-9802252 AAGACCAGCCCCAGAAGGCCGGG - Intergenic
1162453404 19:10768156-10768178 AAGAACAGCCCCTGCTGGCCGGG + Intronic
1163127431 19:15251814-15251836 AAGGAAAGCCCCTGCTGGCCAGG + Intronic
1164088764 19:21929107-21929129 GACAATAGCCCCTGTTGGCTGGG - Intergenic
1165590298 19:36963671-36963693 TAGAAAGGCCCAAGTTGGCCGGG + Intronic
1167093258 19:47359167-47359189 AAGAAAAGTTCCAGATGGCCTGG + Intronic
926293812 2:11552714-11552736 AAAAAGAGCCGCAGTTGGCCGGG + Intronic
927632082 2:24783451-24783473 AAAAATCCCCTCAGTTGGCCGGG + Intergenic
928502000 2:31906263-31906285 AAGAATAGCACTCCTTGGCCGGG - Intronic
929540380 2:42814859-42814881 AATAAGGGCCCCAGATGGCCCGG - Intergenic
929645672 2:43624859-43624881 GAGAAGAGCCCCAGTTGTCCAGG + Intergenic
929773102 2:44909287-44909309 AAGACAAGACCCTGTTGGCCAGG + Intergenic
931293377 2:60897601-60897623 AAGCAAAGCACAAGTTGGCCAGG - Intronic
931464512 2:62474767-62474789 AATAATAGCCCCAGTTTAACTGG - Intergenic
932187451 2:69711032-69711054 AATAATAGCCCAAACTGGCCAGG + Intronic
935286715 2:101571085-101571107 AAGAATTGCCACAGAAGGCCGGG + Intergenic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
936036865 2:109120235-109120257 CAGTATAGGCCCAGCTGGCCTGG + Intergenic
936415880 2:112311083-112311105 AAGAAAAGCCCCAGGTGGGAAGG - Intronic
936440405 2:112546856-112546878 AAGGCTACCTCCAGTTGGCCGGG - Intronic
937371709 2:121302726-121302748 AAAAATAGGGGCAGTTGGCCGGG + Intergenic
942332630 2:174843530-174843552 AAGAATAGCTACATTTGGCCAGG - Intronic
945883820 2:215353855-215353877 AAAAATATCCTTAGTTGGCCAGG - Intergenic
946367597 2:219258984-219259006 AAGAAATGCCCAAGATGGCCGGG + Intronic
946981038 2:225215384-225215406 AACAATAGCACGAGTAGGCCGGG - Intergenic
947213744 2:227731203-227731225 AAAACAAGCCCCAGATGGCCAGG + Intergenic
1172052959 20:32133225-32133247 AAGAATAGTGCCAGTTACCCCGG + Intronic
1172803573 20:37595491-37595513 ACTAATAGACCCAGTTTGCCTGG + Intergenic
1172995557 20:39067836-39067858 GAGAACAGCCCCAGTTATCCTGG + Intergenic
1174793559 20:53502903-53502925 AACAATGGAGCCAGTTGGCCTGG - Intergenic
1174999760 20:55614303-55614325 AAGAAAACCCCCAGCTGGTCTGG + Intergenic
1175160971 20:57007441-57007463 AAAAATAGCAGCATTTGGCCAGG + Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1179441022 21:41394230-41394252 AAGCAGAGCCCCAGGTGACCTGG + Intronic
1182742857 22:32581405-32581427 TAAAATAGCCCCAGTTGGCCGGG - Intronic
1183066480 22:35366960-35366982 AAGAATAGCACCATGAGGCCGGG - Intergenic
1184159356 22:42688719-42688741 AAGAATCTTCCCAGCTGGCCAGG + Intergenic
949465078 3:4335647-4335669 AAAAATAGCCCCAGCTGGCCAGG + Intronic
952690054 3:36194880-36194902 AAGAATAGCCTTTGGTGGCCTGG + Intergenic
959144154 3:102523709-102523731 AAGAATAGTCCTTTTTGGCCGGG - Intergenic
959938657 3:112057495-112057517 TAGGAAAGTCCCAGTTGGCCTGG + Intronic
961074260 3:123967003-123967025 AAGCATTGCCCCAGTGAGCCAGG + Intergenic
961309366 3:125985127-125985149 AAGCATTGCCCCAGTGAGCCAGG - Intergenic
961790559 3:129373535-129373557 AAAAAGAGCCCCAATAGGCCGGG + Intergenic
964288569 3:155149330-155149352 AGGAATAGCCCCTGTTGTCTAGG - Intronic
965071222 3:163917309-163917331 AGGAAGAGCCCCAAGTGGCCAGG - Intergenic
966563142 3:181345792-181345814 AATAATAGGAGCAGTTGGCCAGG - Intergenic
966690037 3:182732399-182732421 AAGTAGAGCCCCAGTGGGGCAGG + Intergenic
966783290 3:183603297-183603319 AAGAAGAGATCCAGCTGGCCAGG - Intergenic
970023210 4:11592414-11592436 AAGATGAGCCCCATTTGTCCAGG - Intergenic
970921193 4:21397056-21397078 AAGAACACCCCCAGTTGCCAAGG - Intronic
972133705 4:35865298-35865320 TAGAAAAGCCACAGGTGGCCAGG + Intergenic
972969036 4:44549534-44549556 ATAAATAGCCCAAGATGGCCAGG + Intergenic
975128972 4:70813601-70813623 AAAAATAGAACCAGTAGGCCAGG + Intergenic
978815964 4:112905955-112905977 AAAAATAGCCCAAGCTGGCCAGG - Intronic
980148213 4:129015374-129015396 AAGAACAGCCTCAGGTGCCCTGG - Intronic
983653629 4:170057658-170057680 AAGCATAGCCATAGTTGGCCAGG - Intergenic
985116264 4:186594354-186594376 AATAATAGTCCCAGGTGGCCGGG - Intronic
985424560 4:189816755-189816777 AAGAATAGGCCAAGTTGGAGAGG - Intergenic
986442572 5:7794793-7794815 AATATTAGCCCCACCTGGCCTGG - Intronic
987654423 5:20787578-20787600 AAGAGCAGCCCCTGTTAGCCTGG - Intergenic
989044742 5:37263801-37263823 AAGAATAGTCCAATTTGGCTGGG + Intergenic
990020986 5:51127542-51127564 AAGAATACCCCAAAATGGCCAGG + Intergenic
990469870 5:56105380-56105402 AAGAACAGCTCCACCTGGCCGGG - Intronic
991399896 5:66241261-66241283 AAGAAAATCACCCGTTGGCCGGG - Intergenic
991605489 5:68396478-68396500 CACAATAGCCCAAGTTGACCTGG + Intergenic
993102426 5:83557149-83557171 TAGAATAGCTGCATTTGGCCAGG + Intronic
996535938 5:124577980-124578002 AATAATAACAGCAGTTGGCCTGG + Intergenic
997869755 5:137497489-137497511 AAGGACTGCCCCAGCTGGCCAGG - Intronic
998071158 5:139198824-139198846 AAAAATAGCATCAGGTGGCCGGG + Intronic
999601435 5:153270640-153270662 AATAATAGCCCGGGCTGGCCAGG + Intergenic
1000247765 5:159463063-159463085 CAGAATAGCCACTCTTGGCCTGG - Intergenic
1000577469 5:162992303-162992325 AAGAATAGTCACAGTTATCCAGG + Intergenic
1001050463 5:168409794-168409816 AAGAATAGCCCCCGGTGACTGGG - Intronic
1001998259 5:176179422-176179444 TAGAAATGCTCCAGTTGGCCAGG - Intergenic
1002357246 5:178640932-178640954 AAGAGTAGCTCCAGATGGCAAGG - Intergenic
1004076349 6:12347352-12347374 AAGAATAGCCCAGGCAGGCCGGG - Intergenic
1004393946 6:15231989-15232011 AAAATTAGCCCCACATGGCCGGG - Intergenic
1005751574 6:28887643-28887665 AACAATAGTCCCACTTGGTCAGG + Intergenic
1006700522 6:35969302-35969324 TAGAAAAGCCGTAGTTGGCCGGG + Intronic
1007238525 6:40408459-40408481 TAGAATAGCATCAGATGGCCAGG - Intronic
1008734319 6:54524121-54524143 AAAAATAGCTCCCGTTGTCCAGG + Intergenic
1010205744 6:73321315-73321337 AAGAATTAGCCCAGTTGGCCGGG + Intergenic
1010954591 6:82075643-82075665 AAGAATAGCTCCATTTGGCCAGG + Intergenic
1011931363 6:92718558-92718580 AAAAACAGTCACAGTTGGCCGGG + Intergenic
1015457831 6:133448928-133448950 TAGAATAGGCACAGTTTGCCTGG + Intronic
1015717883 6:136210862-136210884 AAAATTAGCCTGAGTTGGCCGGG + Intergenic
1016823041 6:148363693-148363715 AAGAAGAGCCTCAATCGGCCGGG - Intronic
1017758084 6:157546601-157546623 AAGAATAGCAGCAGGGGGCCAGG + Intronic
1017934560 6:158993409-158993431 AAAGCAAGCCCCAGTTGGCCGGG - Intronic
1018701634 6:166431921-166431943 AAGAATAGCCCGAACAGGCCGGG - Intronic
1020200651 7:6077169-6077191 AAGATTAGGCCCTGGTGGCCCGG - Intergenic
1022452713 7:30530081-30530103 AAGAGTAGCCCCAGTAGGGTAGG - Intronic
1022765816 7:33410088-33410110 AGAAATGGCCCCAGTTGTCCAGG - Intronic
1023163538 7:37321420-37321442 AAGAAAAGCCCTAGGAGGCCGGG + Intronic
1023446498 7:40237146-40237168 AAGAATAGCCAGGGTAGGCCAGG + Intronic
1024188225 7:46976591-46976613 CTCAATAGCCCCAGGTGGCCAGG - Intergenic
1024897284 7:54274896-54274918 AAGAATAGTGCCACCTGGCCAGG - Intergenic
1025254602 7:57375076-57375098 GAGAATGGCCACAGTTGGCTTGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1030787594 7:113681654-113681676 AAGAACAACCCAGGTTGGCCAGG - Intergenic
1032065251 7:128764129-128764151 AAGAATAGTCTCTGTTGGGCCGG + Intronic
1033105918 7:138523458-138523480 AAAAATAGCCCCTTTTGGCCGGG + Intronic
1034649668 7:152679916-152679938 AAAAATTGCCACAGTAGGCCGGG + Intergenic
1036563783 8:9920845-9920867 AAGAATTGGCCCAATAGGCCAGG + Intergenic
1038601350 8:28946246-28946268 AAGAATATCCCCTATGGGCCGGG - Intronic
1039580962 8:38666622-38666644 ACGAATAATCCCAGTTGGCAGGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042299343 8:67259521-67259543 AAGAATAACCTTGGTTGGCCGGG - Intronic
1044476310 8:92630458-92630480 AAGAAGAGCCCTAGTTTGCTGGG + Intergenic
1047896286 8:129369730-129369752 CAGAATAGGCTCTGTTGGCCGGG - Intergenic
1048498907 8:134958252-134958274 TAAAAAAGCCCCAGTGGGCCAGG + Intergenic
1049088564 8:140496197-140496219 AAGAAAAGGCCCTGTTGGCCGGG - Intergenic
1049740772 8:144239914-144239936 AAGAAAGGCCCCAGATGACCTGG + Intronic
1052751964 9:32501096-32501118 AAGAATGGGCACAGTCGGCCTGG - Intronic
1052763746 9:32619296-32619318 AAAAATACACTCAGTTGGCCGGG + Intergenic
1053340250 9:37320371-37320393 AAAAATAACCGAAGTTGGCCAGG - Intronic
1061060766 9:128249359-128249381 AAGAATAGCGGGGGTTGGCCGGG + Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1187019487 X:15365426-15365448 AAGAATAACCATTGTTGGCCAGG - Intronic
1187090884 X:16095441-16095463 TAGAATAGCCAAAGCTGGCCAGG - Intergenic
1190468733 X:50753933-50753955 ACAATTAGCCCCATTTGGCCTGG - Intronic
1190948024 X:55114977-55114999 AAAAATAGCTACAGTGGGCCAGG + Intronic
1191062857 X:56318126-56318148 AGGACTGGCCCCAGTTGTCCTGG + Intergenic
1192331237 X:70177100-70177122 AAAAACAGCCCCAGTGGGCTAGG + Intergenic
1193558896 X:82993020-82993042 CAGAATTGCCTCAGTTGTCCAGG + Intergenic
1194637050 X:96359012-96359034 ACAAATAGCCCAACTTGGCCGGG + Intergenic
1195818758 X:108918895-108918917 TAGAATAGCTTTAGTTGGCCGGG + Intergenic
1199296051 X:146159911-146159933 GAGAATAGCCACAATAGGCCAGG - Intergenic
1200449445 Y:3306627-3306649 AATAATAGCCCTTGTGGGCCGGG - Intergenic