ID: 1100500770

View in Genome Browser
Species Human (GRCh38)
Location 12:95172022-95172044
Sequence GGGAACAATTCTAAGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100500770 Original CRISPR GGGAACAATTCTAAGGGGGG GGG Intronic
901460721 1:9389780-9389802 TGGGACAATTCGAAGTGGGGAGG - Intergenic
902188314 1:14742061-14742083 TGGGACAATTCCAAAGGGGGAGG - Intronic
902392486 1:16114713-16114735 GGGAACAGTGCTGAGGAGGGTGG + Intergenic
904980554 1:34497433-34497455 GGGAACAATGCTGGGGGGTGAGG - Intergenic
906377306 1:45305415-45305437 GGGGACAACTCGAAGTGGGGAGG - Intronic
916888359 1:169092422-169092444 GTGAAAAATTCTAGGGGTGGAGG - Intergenic
920000697 1:202796671-202796693 GGGCACATTTCTAAGGAGAGTGG - Intronic
921720420 1:218464837-218464859 GTGAACAATGCTCAGGGGAGAGG - Intergenic
924452451 1:244190513-244190535 GGGAGCAATTCTCAGGGAGGGGG + Intergenic
1067471635 10:46542203-46542225 GGGAACAAATCTGAGTGGAGGGG + Intergenic
1069077656 10:64054999-64055021 GGCAACTATTCAATGGGGGGGGG - Intergenic
1069758056 10:70785741-70785763 GGGACCCATTCTCAGGGAGGTGG + Intergenic
1076672121 10:132128272-132128294 AGGAACAATTCTAAGAGTGATGG - Intronic
1077927768 11:6698867-6698889 GGGAACAATTCCCTGGGGGAGGG + Intergenic
1078022831 11:7669829-7669851 GGGCACAATGTTAAGAGGGGTGG + Intronic
1083904686 11:65662196-65662218 GGGAACAGTTCTGAAAGGGGAGG + Exonic
1084879178 11:72158100-72158122 TGGGACAATTCAAAGTGGGGTGG - Intergenic
1084962778 11:72726055-72726077 GGAAACAGTTCTGAGGAGGGAGG + Intronic
1091626123 12:2122217-2122239 TGGAAGAATTCTAAAGGAGGTGG + Intronic
1091671760 12:2457119-2457141 AGGAACAAGTCAAAGAGGGGGGG + Intronic
1099628962 12:85115585-85115607 GGGAACAATTCTAGGGAATGTGG - Intronic
1100121421 12:91373379-91373401 AGGGACAATTCAAAGTGGGGAGG - Intergenic
1100500770 12:95172022-95172044 GGGAACAATTCTAAGGGGGGGGG + Intronic
1100560108 12:95739889-95739911 CGGAACAATTCTGAGGGTGAGGG - Intronic
1101252792 12:102951765-102951787 GGGGACAATTTAAAGGGGAGGGG - Intronic
1102497871 12:113331945-113331967 GGGAAGAATGCTAAGAGAGGAGG - Intronic
1104078276 12:125409464-125409486 GGCAACACTCCTAAGAGGGGTGG + Intronic
1107297485 13:38926159-38926181 GGGAACAGCTCAAAGGCGGGGGG - Intergenic
1107908394 13:45082903-45082925 GGGAGCAAGTGTAAGGGGGAGGG - Intergenic
1110739040 13:78972849-78972871 GGGAACAATTTTCAGGTGAGTGG + Intergenic
1114264409 14:21064158-21064180 GGGAATAATTCAAAGTGCGGAGG + Intronic
1114441422 14:22751426-22751448 TGGAACAACTCAAAGGAGGGAGG + Intergenic
1116517267 14:45817607-45817629 GGGAACAATATCATGGGGGGGGG + Intergenic
1116517503 14:45818935-45818957 AGGAACAGTATTAAGGGGGGGGG + Intergenic
1121265350 14:92598910-92598932 GGTAACAACTCTGAGGGGTGAGG + Intronic
1122381681 14:101311347-101311369 TGGGACAACTCTAAGCGGGGAGG + Intergenic
1124375637 15:29127188-29127210 GGGAACCACTCTACGGGGGCTGG + Intronic
1126317920 15:47390527-47390549 GTGAGCAATTCAAATGGGGGTGG - Intronic
1127652650 15:61024175-61024197 GGGAACAAGTCAAACTGGGGTGG + Intronic
1128269440 15:66295182-66295204 GGGACCTTTTCTAAGGTGGGGGG - Intronic
1131535308 15:93232464-93232486 GGGGACAATGCTAAGGGCTGAGG + Intergenic
1134293907 16:12927760-12927782 GGGGACAGATCTATGGGGGGTGG - Intronic
1136574358 16:31114564-31114586 GGAAACAATTCTGAGAGGAGTGG - Intergenic
1137312932 16:47284655-47284677 GAAAACAATTTTAATGGGGGTGG - Intronic
1139367505 16:66442384-66442406 GGGAACAGATCTAAGGAAGGAGG + Intronic
1139418361 16:66832241-66832263 GAGAACAATTGGGAGGGGGGTGG + Intronic
1141116752 16:81315508-81315530 GGGGACAACTCCAAGGGGCGCGG - Intronic
1143251072 17:5523467-5523489 TGCAACAAATCTAAGCGGGGGGG - Intronic
1143292503 17:5842375-5842397 GGGAACAATATCATGGGGGGAGG + Intronic
1145024714 17:19459438-19459460 GAGGACAATTTGAAGGGGGGTGG - Intergenic
1147314504 17:39613071-39613093 GGAAACAATTCGGAGGGGGCTGG - Intergenic
1147513614 17:41095532-41095554 CGGGACAACTCTAAGTGGGGAGG - Intronic
1147515718 17:41115822-41115844 CGGGACAAGTCTAAGCGGGGAGG - Intergenic
1148153764 17:45411283-45411305 GGAAGCACTTCTAAGGGAGGAGG - Intronic
1148434411 17:47671320-47671342 CTGAACAATTCTAAGGTAGGTGG - Intronic
1148556784 17:48583288-48583310 GAGAACGATTCTTCGGGGGGAGG - Intronic
1148731356 17:49838726-49838748 GGGAAGACTTCTAAGGGTGGAGG - Intronic
1150418695 17:65008802-65008824 GGGAACTATTATAAGGGGTGTGG + Intergenic
1151132889 17:71916486-71916508 TGGAACAATTCAAAGGTTGGGGG - Intergenic
1152054856 17:78016563-78016585 GGGAACCAAATTAAGGGGGGTGG + Intronic
1153635685 18:7110892-7110914 GAGAACAATTAGAAGTGGGGGGG - Intronic
1155536247 18:26821204-26821226 GAGAAAAATTCTAAGAGGTGCGG - Intergenic
1155543134 18:26887272-26887294 GGGAACAATTTCACGGGGTGGGG + Intergenic
1157453759 18:47808196-47808218 AGGAACTATTCTAAGGGTTGAGG + Intergenic
1157746927 18:50144129-50144151 GTTAATATTTCTAAGGGGGGTGG - Intronic
1159604666 18:70462657-70462679 GGAAACAATTCTTGGGAGGGGGG - Intergenic
1160076479 18:75681954-75681976 GGGAACATTTCTATGTGAGGGGG - Intergenic
1161985070 19:7648582-7648604 TGGAACAGTTCTAGGGGGGTTGG - Intergenic
1162158619 19:8696375-8696397 GGGAAAAATCCTGAGGGGAGGGG + Intergenic
1168103857 19:54155213-54155235 GGGGACAATTCTTAGGGCTGTGG - Exonic
1168625916 19:57917778-57917800 GGGAACAACTCGAAGCAGGGAGG - Intergenic
926361608 2:12093167-12093189 AGAAACAATTCCAGGGGGGGAGG - Intergenic
926503493 2:13682682-13682704 GGAAACAACTCGAAGAGGGGAGG - Intergenic
928738250 2:34318602-34318624 GGGAAGAATTCAAAGGGGATTGG - Intergenic
928905001 2:36358070-36358092 GGGAACTCTTCTCAGAGGGGAGG + Intronic
934656782 2:96120526-96120548 GGGGGCAGTTCTAAGGGGTGGGG - Intergenic
936619228 2:114077551-114077573 GGGAACATTTCTAAGGGTCAGGG - Intergenic
937100638 2:119265303-119265325 GGAAGCAATTATAAGGTGGGTGG + Exonic
941429111 2:165390097-165390119 GGAACCAATTTAAAGGGGGGAGG + Exonic
946865974 2:224040938-224040960 GGGAACAATTCAAAGGAGGGGGG + Intergenic
1169168818 20:3447457-3447479 GGGAACAAATGTAGGGGAGGTGG + Intergenic
1173013491 20:39203950-39203972 GGGAGCAATTGAAAGGGGGAAGG - Intergenic
1173454320 20:43190658-43190680 GGGAAAAATTGTAGGGGGTGGGG - Intergenic
1177526109 21:22292511-22292533 GGAAACTATTCAAAGGTGGGTGG + Intergenic
1178516780 21:33254717-33254739 TGGGACAATTCGAAGTGGGGGGG - Intronic
1178913796 21:36696093-36696115 TGGAACATTTCTAAGAGGTGGGG + Intergenic
1179186056 21:39086122-39086144 TGGAACCATTCTAAGGGTGTGGG - Intergenic
1182546542 22:31080091-31080113 GGGACCACTTCTCAGGGGTGTGG + Intronic
1183912652 22:41091481-41091503 GGGGAGGATTTTAAGGGGGGAGG - Intergenic
958642875 3:96830754-96830776 GAGAACAATTCTTAGGGGTAAGG + Intronic
960597426 3:119418998-119419020 GGGAACAATTTGTGGGGGGGAGG - Exonic
964074535 3:152677200-152677222 GGGAACAATACAAAGGAGGATGG + Intergenic
964607985 3:158578719-158578741 GTGAGCAATTCTAAGAGAGGAGG + Intronic
964889632 3:161519655-161519677 AGGAACAATATTACGGGGGGCGG + Intergenic
968454556 4:690380-690402 GGGAACAAAGATGAGGGGGGAGG - Intergenic
969692033 4:8709113-8709135 GGGCATCATTCTAAGAGGGGAGG + Intergenic
970851722 4:20611946-20611968 GGGAACAAATCTAAGTGCTGTGG + Intronic
973830778 4:54756692-54756714 GGGATGACTTCTAAGGGGGCAGG + Intergenic
975354531 4:73385799-73385821 GGGATCAATAATAAGAGGGGAGG - Intergenic
978536252 4:109766283-109766305 GGGGACAATTCTAAAGGGCTGGG + Intronic
981049903 4:140299651-140299673 CGTTACAATTCTAATGGGGGAGG - Intronic
981804670 4:148700562-148700584 GGGAACAACTCTAAGGTCTGTGG - Intergenic
982297928 4:153849047-153849069 GAGAACAAGTCTAAGAAGGGAGG - Intergenic
982573401 4:157076961-157076983 GGGAAGAATCCTGGGGGGGGGGG + Intronic
983896507 4:173086858-173086880 GGGACCAATTCTCAGGAAGGTGG + Intergenic
984128740 4:175846058-175846080 AAGAACAATTCTTATGGGGGTGG - Intronic
985778290 5:1856829-1856851 GGGAGCATTTCCAAGGGAGGAGG + Intergenic
988708140 5:33745475-33745497 GGGAGGCATTCTAAGGTGGGAGG - Intronic
990907846 5:60822827-60822849 GGGAAAAATTCTGAAGAGGGAGG + Intronic
991957138 5:72006228-72006250 GGGAATAATTGTAGTGGGGGTGG + Intergenic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
999645328 5:153711963-153711985 GAGAAGAAGTCTAAGGCGGGGGG + Intronic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1003195147 6:3907761-3907783 CGGAACAACTCAAAGTGGGGAGG - Intergenic
1004138066 6:12988004-12988026 GTGCACATTTCTAAGGGGGTTGG + Intronic
1004356390 6:14933201-14933223 GTTAATAATTTTAAGGGGGGTGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007056087 6:38886290-38886312 GGTAACATTTCCAAGGAGGGGGG + Intronic
1008380277 6:50833387-50833409 GGGACCAATACTAAGGAGAGAGG + Intronic
1011648122 6:89479768-89479790 AGAAACAATTCTAGGGGAGGCGG - Intronic
1013615924 6:111842943-111842965 GTAAACAATTCTAAGGCAGGAGG + Intronic
1015447967 6:133329891-133329913 GGGATCAATTCTAAAGGAGAAGG + Intronic
1022165106 7:27751717-27751739 GGTAGCAATTGTAAGGGAGGAGG + Intronic
1023471954 7:40532079-40532101 GGGAACTAGCCTAAGGGGTGAGG + Intronic
1027574162 7:79910708-79910730 GGCAAGTATTCTAAGGGGAGAGG + Intergenic
1032741466 7:134743448-134743470 CTGAGCAAATCTAAGGGGGGTGG + Intergenic
1033610384 7:142958961-142958983 TGGAACAACTCAAAGGGGTGGGG - Intronic
1033795489 7:144840487-144840509 TGGAACAATTTTCAGGGGAGAGG - Intergenic
1039863918 8:41484332-41484354 AGGTACAATTCTAAGGAGGGAGG + Intergenic
1043633654 8:82366229-82366251 AGGAACAATACCATGGGGGGTGG - Intergenic
1047137000 8:122090624-122090646 GGGAACAATGTTAAATGGGGTGG - Intergenic
1048797507 8:138164664-138164686 CGGGACAATTCTAAGCGGGGAGG - Intronic
1055013087 9:71588272-71588294 GAGAAAAATTCTATGGGGGCTGG + Intergenic
1056632164 9:88302918-88302940 GAGAACCATTCTAATGGGGAAGG - Intergenic
1059248358 9:112867010-112867032 GGGAGGAATTCTGAGGAGGGGGG - Intronic
1059248436 9:112867329-112867351 GGGAAGAGTTCTGAGGAGGGAGG - Intronic
1059248445 9:112867369-112867391 GGGAAGAGTTCTGAGGAGGGAGG - Intronic
1061245648 9:129400230-129400252 GGGGACTATTCTAAGGGGAGTGG - Intergenic
1186239740 X:7553728-7553750 AGGAAGAATACTAAGGGGGCCGG + Intergenic
1189016920 X:37294580-37294602 GAGAACAGTGCCAAGGGGGGTGG + Intergenic
1189551211 X:42095568-42095590 GGGGACAACTCGAAGTGGGGAGG + Intergenic
1191776582 X:64821303-64821325 GGAAAGAATTCTAAGGAGGACGG + Intergenic
1192667515 X:73102814-73102836 GAGAACAATCCTAAGGGGGATGG - Intergenic
1192849021 X:74934180-74934202 GGTAACAATTCTAAGGGTAGGGG - Intergenic
1197701564 X:129604043-129604065 GGGAAGAATGCGAAGTGGGGTGG + Intergenic
1201310476 Y:12594586-12594608 GGGAACAATGTTAATGGTGGGGG + Intergenic