ID: 1100500834

View in Genome Browser
Species Human (GRCh38)
Location 12:95172548-95172570
Sequence TCATTCCCAAGCATAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100500831_1100500834 -4 Left 1100500831 12:95172529-95172551 CCTATTATGCAGACAAATATCAT 0: 1
1: 0
2: 1
3: 16
4: 203
Right 1100500834 12:95172548-95172570 TCATTCCCAAGCATAGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100500834 Original CRISPR TCATTCCCAAGCATAGGGAG AGG Intronic
901627255 1:10631304-10631326 TCCCTCCCCAGCAGAGGGAGGGG - Intergenic
915905511 1:159873901-159873923 ACATTTCCAAGCATAGAGGGAGG - Intronic
916459781 1:165011470-165011492 TCATTGCCAGGGGTAGGGAGAGG + Intergenic
916870029 1:168903669-168903691 TCATTCCCCTGCCTAGAGAGAGG + Intergenic
916909085 1:169325273-169325295 TGACTCCCAAGGACAGGGAGGGG + Intronic
918410989 1:184257625-184257647 CCATTCCTAAGGATAGGGTGAGG + Intergenic
919074848 1:192800407-192800429 TCAACGCCAAGCATAGGCAGAGG - Intergenic
922970994 1:229737966-229737988 TAATTCCCATGCATAGTGGGAGG - Intergenic
923779893 1:237012808-237012830 TGTTTCATAAGCATAGGGAGAGG + Intergenic
1063366337 10:5493192-5493214 TCCTGCCCAAGAAGAGGGAGAGG + Intergenic
1064477951 10:15711703-15711725 TGATTTCCAGGCATTGGGAGTGG - Intronic
1067088502 10:43255010-43255032 CCATTCCCAGGCATCTGGAGAGG + Intronic
1070326267 10:75391329-75391351 TCATTCCAAACCACAGGAAGAGG - Intergenic
1074069887 10:110056553-110056575 TATTTCCCAAGCATAAGGAAAGG - Intronic
1076379623 10:130015997-130016019 TCTCTCCCACGCAGAGGGAGGGG - Intergenic
1077348214 11:2074329-2074351 ATCTTCCCAAGCATGGGGAGGGG + Intergenic
1078569797 11:12447807-12447829 TCATTCCCCAACACTGGGAGTGG - Intronic
1079723803 11:23853618-23853640 CGAATCCCAAGCATATGGAGGGG + Intergenic
1080704374 11:34676329-34676351 TCATTGGCAAGCAGAGGGATTGG + Intergenic
1084654533 11:70507489-70507511 TCTTTCCCCTGCAGAGGGAGAGG + Intronic
1084939861 11:72606768-72606790 TCCTGCCCAGGCAGAGGGAGGGG + Intronic
1087376544 11:97349724-97349746 ATGTTCCCAAGCATAAGGAGTGG + Intergenic
1091988454 12:4933928-4933950 TCATTCCCAAGCAAAAAGAAGGG - Intergenic
1093781069 12:23138096-23138118 TCTTTCCCATGCATTGAGAGTGG + Intergenic
1094449713 12:30571873-30571895 TCCTTCCAAAACATGGGGAGGGG - Intergenic
1095113222 12:38321478-38321500 ACATTCCCAAGCTTTGTGAGGGG - Exonic
1097545067 12:60988607-60988629 TTATACCTAAGCATGGGGAGGGG + Intergenic
1100500834 12:95172548-95172570 TCATTCCCAAGCATAGGGAGAGG + Intronic
1100531211 12:95463305-95463327 TCATTCTCTATCTTAGGGAGCGG + Intergenic
1100936389 12:99672683-99672705 TGAATCCCAACCTTAGGGAGAGG + Intronic
1109725546 13:66336130-66336152 TCACTCCTGTGCATAGGGAGTGG - Intronic
1112289965 13:98137577-98137599 TCATTCTCAAGCATGGTTAGTGG + Intergenic
1113633929 13:111907137-111907159 TCATTACCAAGGAAATGGAGAGG + Intergenic
1114679339 14:24471682-24471704 TCATTTCCAAGCACAGAGTGGGG - Intergenic
1116093369 14:40336656-40336678 TTATTCCCAAGGCTAGTGAGTGG + Intergenic
1117662855 14:58026311-58026333 TCATGATCAAGCATAGGGGGAGG - Intronic
1118570065 14:67185844-67185866 TCATTCCCAATTATAGAAAGTGG + Intergenic
1119465713 14:74856568-74856590 TCATTCTGAAGCTTAGTGAGAGG - Intronic
1120960637 14:90121459-90121481 TCATTCCCAAGCATTGTAATGGG + Intronic
1122846778 14:104504561-104504583 TCAGTCCCAAGCAAAGGGATGGG - Intronic
1125600788 15:40914895-40914917 ACATGTCCAAGGATAGGGAGAGG - Intergenic
1128678140 15:69626849-69626871 TAATTTCCAAGCAGAGGGACGGG - Intergenic
1129604272 15:77017192-77017214 ACATTCCCAGGCTTGGGGAGTGG - Intronic
1129701730 15:77772196-77772218 TCATTCTCAGGGACAGGGAGAGG - Intronic
1134751043 16:16625394-16625416 TCATCCCCAACCACAGGGATTGG - Intergenic
1134994413 16:18728197-18728219 TCATCCCCAACCACAGGGATTGG + Intergenic
1139428663 16:66899454-66899476 CCAATCCCAGGCATAGGCAGAGG - Intergenic
1140775966 16:78249197-78249219 TCTTTCCCAAGCTCATGGAGTGG + Intronic
1142001587 16:87667375-87667397 TCTTTGCCAAGCACAGGCAGTGG + Intronic
1142160788 16:88556341-88556363 TCATTCCCAAGGTTAGGGGAGGG + Intergenic
1142770591 17:2094005-2094027 TCTTTCTGAAGAATAGGGAGAGG - Intronic
1147056968 17:37842411-37842433 ACATTCCCAAGCAAAAGCAGGGG + Intergenic
1150316841 17:64175953-64175975 TCATTTCCAAAAATGGGGAGAGG + Intronic
1150844768 17:68644315-68644337 TCATTCCCAACCATAGGTCCTGG - Intergenic
1155687397 18:28572288-28572310 CCATTACCAATTATAGGGAGAGG + Intergenic
1156017130 18:32559562-32559584 TGATTCCCAAGGAATGGGAGTGG + Intergenic
1156541109 18:37911498-37911520 TGATTCTGAAGCATAGGGTGAGG - Intergenic
1157862461 18:51153614-51153636 TCAAACCCAGGCCTAGGGAGAGG - Intergenic
1158448700 18:57543885-57543907 TCATTCTCAAGATTAGGCAGTGG - Intergenic
1164401188 19:27903401-27903423 TGATTCCCAAGCAGCAGGAGTGG - Intergenic
927509324 2:23634630-23634652 TCACACCCAAGCATCCGGAGGGG + Intronic
928179229 2:29056274-29056296 TGATTCCGAAGCACAGTGAGAGG - Exonic
931464191 2:62472504-62472526 TCACTCCAAACCTTAGGGAGTGG + Intergenic
936271822 2:111054896-111054918 TCATTCCCAAGCTGAGGGAAAGG - Intronic
943534741 2:189133928-189133950 TCATTTTCAAGCAGAGGGTGTGG - Intronic
944473670 2:200082516-200082538 TCATTTCTAAGCATTTGGAGTGG - Intergenic
946095338 2:217269895-217269917 TCATTTCCAAGCAAAAGGTGGGG - Intergenic
1170535569 20:17337626-17337648 TCATTTAAAAGCATTGGGAGAGG + Intronic
1172850111 20:37955676-37955698 TCATTTACCAGCATGGGGAGTGG + Intergenic
1173868148 20:46325966-46325988 CCATTCCCCAGCAAAGGGTGAGG + Intergenic
1174690793 20:52502505-52502527 TTATTCCTAAGCATAGGAAAGGG + Intergenic
1175784528 20:61704263-61704285 TCCTTCCCAAGCAGAAGTAGTGG + Intronic
1177013501 21:15756277-15756299 CCCTTCCAAAGCACAGGGAGAGG - Intronic
1179114932 21:38482184-38482206 ACCTTCCCAAACATAGGGAAAGG + Intronic
1179913712 21:44463085-44463107 CCTTTCCCAAGCAGAGGGATGGG + Intergenic
952391211 3:32882099-32882121 CCATTCCTATGCAAAGGGAGTGG + Intronic
955759686 3:62265678-62265700 TCAATCCAAAGACTAGGGAGAGG - Intronic
955780593 3:62479882-62479904 TTTTTCCCAAGCATAGGTTGGGG - Intronic
955876618 3:63496887-63496909 TCATTGCCAAGCATAGTGCCTGG - Intronic
960239080 3:115319005-115319027 TCATTCCAAAGCATGGTGAATGG + Intergenic
960573979 3:119211366-119211388 TCCTTCCCAAGCAGGGAGAGAGG - Intergenic
961698521 3:128723743-128723765 TCATTCCCAAGGAGCAGGAGGGG - Intergenic
965230962 3:166052365-166052387 TCAGACCCATGCATAGAGAGTGG + Intergenic
967024956 3:185556690-185556712 ACATTCCCGAGAATGGGGAGAGG + Intergenic
975948118 4:79733787-79733809 TAACTCCCAAGCATTGGTAGAGG + Intergenic
977319541 4:95495230-95495252 ACATTCCCAAGAGAAGGGAGTGG - Intronic
980882046 4:138720995-138721017 TAATACTCAAGCATATGGAGGGG - Intergenic
984961497 4:185102088-185102110 TCACTCGCAAGAGTAGGGAGAGG + Intergenic
990042135 5:51388533-51388555 TCATTCCCAAGGAAGAGGAGTGG + Intronic
991395354 5:66198917-66198939 CTATTCCCAAGCAGAGGGAAGGG + Intergenic
993844428 5:92922846-92922868 TCCTTCCTAACCACAGGGAGAGG - Intergenic
994450447 5:99934840-99934862 TCACTCCCCATCATAGGTAGAGG + Intergenic
994688600 5:102988332-102988354 TCCTTCCCAAGGATAGGGCTGGG - Intronic
996502827 5:124235773-124235795 TCATTCCAAATCAAAGGGAGAGG - Intergenic
997599304 5:135128311-135128333 TCATTGCCAAGCACAGTGTGGGG + Intronic
1000048575 5:157542213-157542235 TCCTTCCCTAGAAAAGGGAGGGG - Intronic
1001204334 5:169747965-169747987 TCCTTCCCAAACACAGGGATAGG - Intronic
1002053934 5:176587699-176587721 CCTTTCCAAAGCATAGGGAATGG - Intronic
1005521777 6:26607883-26607905 TTATTCCCCACCATAGTGAGTGG + Intergenic
1007311393 6:40948935-40948957 TCATAGCCAAGCACAGGGAAGGG + Intergenic
1008620830 6:53270123-53270145 TCATTCCTAAGCATATGATGTGG - Intronic
1011946316 6:92908385-92908407 TCAAGCCCAAGCTTAGGGGGTGG + Intergenic
1012957888 6:105590541-105590563 TCACTTCCAAGCATAAGAAGAGG + Intergenic
1015110004 6:129582044-129582066 ACATCCCCAAGCATAAGGAAAGG + Intronic
1016917705 6:149260155-149260177 TCATTTCCATGTAAAGGGAGAGG + Intronic
1018218316 6:161552257-161552279 TCATTCACAGTCATAGGCAGAGG - Intronic
1019999214 7:4745301-4745323 TCATTCCCAGGAGTCGGGAGTGG + Intronic
1022556493 7:31303161-31303183 TCATTCCTGGGCATTGGGAGAGG - Intergenic
1022849878 7:34249301-34249323 CTATTCACAAGCACAGGGAGAGG + Intergenic
1023068039 7:36398963-36398985 TCATTTAAAAGAATAGGGAGGGG + Intronic
1023869800 7:44257112-44257134 ACATTCCCAAGCAAGGGGAGTGG + Intronic
1024222318 7:47298405-47298427 GCATTTCCAAGAAGAGGGAGTGG + Intronic
1026315897 7:69226968-69226990 TTATTCCAAAGCAGAGGGTGGGG - Intergenic
1027404439 7:77845096-77845118 TCATTTCCAAGGAGAGGGAATGG + Intronic
1029722348 7:102377109-102377131 CAATTCGCAAGCATAGGTAGAGG - Intronic
1029884514 7:103853663-103853685 TTATTCCCAACTATAGGTAGAGG - Intronic
1030223533 7:107123950-107123972 TCATTCCCAAGCATGTGGTATGG - Intronic
1031271767 7:119658754-119658776 TCAGTCGCTACCATAGGGAGTGG + Intergenic
1031806973 7:126318268-126318290 TAATCCCCAAGTATTGGGAGAGG - Intergenic
1032604386 7:133333390-133333412 TAATTCCAAGGCAAAGGGAGGGG - Intronic
1037884214 8:22587942-22587964 TCATTCCCAACCAGAGGGAGAGG - Intronic
1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG + Intronic
1039250573 8:35659886-35659908 TCCTTCCCAAGAATGGGTAGTGG - Intronic
1040781726 8:51117422-51117444 CCAGTCCCAAGCATGGGGTGGGG - Intergenic
1041756692 8:61321479-61321501 CCATTCCCACGCATATGCAGTGG - Intronic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1042926263 8:73971690-73971712 TCAGTCCCTAGCCCAGGGAGAGG - Intronic
1049594935 8:143478975-143478997 ACATTCCCAAGCATGAAGAGCGG - Intronic
1059766003 9:117384792-117384814 TCAATCCCTAGCAAAGGGAATGG + Intronic
1061992966 9:134170149-134170171 ACATTCCCAGGAATAGCGAGAGG + Intergenic
1186101560 X:6162934-6162956 TAATTCCCACGTATAGGGAGAGG + Intronic
1187285297 X:17898601-17898623 TGTCTCCCAAGCAGAGGGAGGGG - Intergenic
1188001095 X:24982755-24982777 TCATTCACAAGCAAAGCCAGTGG - Intronic
1188940015 X:36225893-36225915 TGATCCCAAAGCATAGGTAGGGG + Intergenic
1189166983 X:38870155-38870177 TCATTCTCAGGCAAAGGCAGAGG - Intergenic
1189995279 X:46631747-46631769 TCTTCCCGAAGCATAAGGAGTGG + Intronic
1191662953 X:63669378-63669400 TCATTGCCCAGCATAGGGCCTGG + Intronic
1192268463 X:69556428-69556450 TCATTCCCAAGGATAGGAGAGGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1200088417 X:153623225-153623247 TAATTTCCAAGCATGGGGATAGG + Intergenic