ID: 1100501980

View in Genome Browser
Species Human (GRCh38)
Location 12:95183166-95183188
Sequence CTTTATCAGCAGAAGCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100501980_1100501985 5 Left 1100501980 12:95183166-95183188 CCACTATGCTTCTGCTGATAAAG 0: 1
1: 0
2: 2
3: 11
4: 217
Right 1100501985 12:95183194-95183216 TGGCCACCCTCTTAGTCACAAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1100501980_1100501988 11 Left 1100501980 12:95183166-95183188 CCACTATGCTTCTGCTGATAAAG 0: 1
1: 0
2: 2
3: 11
4: 217
Right 1100501988 12:95183200-95183222 CCCTCTTAGTCACAAGGACCAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100501980 Original CRISPR CTTTATCAGCAGAAGCATAG TGG (reversed) Intronic
902115476 1:14117513-14117535 CTTTATCAGCAGCATGAAAGTGG + Intergenic
902165527 1:14568352-14568374 CTTTATCAGCAGCATGAAAGCGG - Intergenic
903157387 1:21455586-21455608 ATTTCTCAGCAGCTGCATAGTGG + Intronic
905466464 1:38157874-38157896 CTTTATCAGGAGACTCACAGGGG + Intergenic
905739253 1:40355118-40355140 CTTTATCAGTATCAGCATAAGGG - Intronic
907190176 1:52641611-52641633 CGTTGTCAGCAGAACCATGGAGG + Intronic
907643658 1:56218667-56218689 CTTTATTTGCATAGGCATAGAGG + Intergenic
907698990 1:56765136-56765158 TGTTATCAGCAGAAGCCTACTGG - Intronic
908865001 1:68537703-68537725 CCTTCTCAGCAGAAGCCTACAGG - Intergenic
909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG + Intergenic
910489895 1:87757199-87757221 CTTTATAAGCATAGGCCTAGTGG - Intergenic
910642820 1:89481789-89481811 CTTTATCAGCAGCAGGACAATGG - Intergenic
911307983 1:96254766-96254788 CTTTATCAGCAGCATGAAAGTGG + Intergenic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
919163606 1:193863661-193863683 CTTTATCAGCAGCATGAAAGCGG + Intergenic
923288024 1:232515694-232515716 CTTTGTGGGCAGAAGCAGAGGGG - Intronic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1063963642 10:11327865-11327887 CTTTAATAGCAGATGGATAGAGG + Intronic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1067548909 10:47219515-47219537 CTTTGTCAGCAGAAACAAAACGG - Intergenic
1070407587 10:76110824-76110846 CTTTATCAGCAGCATCAAAATGG + Intronic
1073404212 10:103282867-103282889 CTATATCATCAAAAGGATAGAGG + Intronic
1074180397 10:111057800-111057822 CTTTGTCTTCAGAATCATAGTGG - Intergenic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1079720815 11:23811466-23811488 CCATATCACCAGAAGCAAAGAGG - Intergenic
1080341558 11:31271672-31271694 CTTTATCAGCAGCATGATAATGG - Intronic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1082955073 11:58862148-58862170 ATTTATGAGCAGAAGCTTATCGG - Intronic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1089340218 11:117752275-117752297 CTTTGTCAGCCAAAGCCTAGGGG + Intronic
1090960163 11:131549200-131549222 GTTTGACAGCAGAAGCATGGAGG + Intronic
1093207219 12:16264920-16264942 CTTTATCAGCAGCATGAAAGTGG + Intronic
1093211363 12:16313037-16313059 CTTTATCAGCAGCAGTAAAATGG + Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1097711662 12:62923989-62924011 TTTTAAAACCAGAAGCATAGAGG - Intronic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1103220278 12:119238736-119238758 CTTTTTCAGAGGAAGTATAGAGG - Intergenic
1106819017 13:33442745-33442767 CATTAGAAGCAGAGGCATAGGGG + Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108434954 13:50392685-50392707 TTATATCAGCAGATGAATAGAGG + Intronic
1108871679 13:54994536-54994558 CTTTATCAGCAAAAGGATTGTGG + Intergenic
1109233281 13:59784901-59784923 CTCTATAACCAGAATCATAGAGG - Intronic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1111527456 13:89491427-89491449 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1115822170 14:37224349-37224371 CTTTATCAGCAGCATGAAAGTGG - Intronic
1116639199 14:47439536-47439558 CTGAATCACCACAAGCATAGAGG - Intronic
1116937292 14:50754311-50754333 CTTTATCATCAGCAGAATTGAGG - Intronic
1117699640 14:58400023-58400045 CTCTAACAGCATAAGAATAGAGG - Intronic
1118556093 14:67024423-67024445 CTTTATCAAGAGAAGTACAGGGG + Intronic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1119216177 14:72870922-72870944 CTTTATCAGCAGCATGAAAGTGG - Intronic
1120541804 14:85760347-85760369 TTTTATCAGCAGAAACCTGGAGG - Intergenic
1123146421 14:106135069-106135091 CTTTTTCAGCACATGCATGGTGG - Intergenic
1126648104 15:50895061-50895083 TCTTATCAGCAGAACCACAGAGG - Intergenic
1128616800 15:69116631-69116653 CCTTAAAGGCAGAAGCATAGTGG - Intergenic
1129650515 15:77484073-77484095 CTTTAACAGCATAAGTAAAGAGG + Exonic
1129748801 15:78045030-78045052 CTTTTTCTGCAGAAGCATTTGGG + Exonic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1131868990 15:96742310-96742332 TATTGTGAGCAGAAGCATAGTGG + Intergenic
1132674383 16:1115642-1115664 CTTGCTCAGCAGAACCATGGAGG + Intergenic
1133692371 16:8229206-8229228 CTTTGTCAGTAGCAGCACAGGGG + Intergenic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1133867980 16:9661559-9661581 GTTTGTCTGCAGAAGCAAAGAGG + Intergenic
1135988565 16:27202826-27202848 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1136692643 16:32046440-32046462 CTTTTTCAGCACACGCATGGTGG + Intergenic
1136793140 16:32989666-32989688 CTTTTTCAGCACACGCATGGTGG + Intergenic
1136876713 16:33864391-33864413 CTTTTTCAGCACACGCATGGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1203095396 16_KI270728v1_random:1251357-1251379 CTTTTTCAGCACACGCATGGTGG + Intergenic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG + Intergenic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1149133040 17:53330702-53330724 CATTCTCAGGAGAAGCATAAAGG + Intergenic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1155135968 18:22993207-22993229 CTTTATCAAAAGAAGCTTGGGGG - Exonic
1155361259 18:25005172-25005194 CTTTATCTGGAGATGCATAAGGG + Intergenic
1156728070 18:40154445-40154467 CTTTATGACCAGTAGCATTGAGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1159069866 18:63611681-63611703 CTTTTTCACTAGAAGTATAGAGG + Intergenic
1162381003 19:10331948-10331970 CTTTATCAGCAGGAGGAAATTGG - Intronic
1164071268 19:21770585-21770607 TTTTATTGGCAGAAGCACAGTGG + Intergenic
925002321 2:415026-415048 ATTTTTCAGCAGAAACCTAGAGG - Intergenic
925151975 2:1621103-1621125 CTTTATCAGCAGCATGAAAGTGG + Intergenic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
926932408 2:18053659-18053681 CTTTATCAGCAGCATGATAATGG - Intronic
927011016 2:18904374-18904396 CTTTATCAGCCGAGTTATAGAGG + Intergenic
927922709 2:26985794-26985816 CTTTATAAGCAGGAGGACAGAGG + Intronic
929061247 2:37926193-37926215 CTTCATCAGCAGACCCTTAGAGG - Intronic
930227943 2:48813226-48813248 CTTTATCAGCAGCATGATAATGG - Intergenic
930254845 2:49078092-49078114 CTTTATCAGCAGCATGAAAGTGG - Intronic
933003290 2:76954853-76954875 ATTTATCAGCAGAAACCTTGTGG + Intronic
933074302 2:77903929-77903951 CTTTATGAGAAAAAGAATAGGGG - Intergenic
933889194 2:86750843-86750865 TTTCAACAGCAGAAGCAAAGTGG - Intronic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
935029049 2:99304459-99304481 CTTTATCAGCAGCATGAAAGTGG + Intronic
935243363 2:101197003-101197025 CTTTCTCAGCAGAAACACTGTGG - Intronic
935625763 2:105171197-105171219 CTTTATCAGCAGCATCAAAACGG - Intergenic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
940501849 2:154503620-154503642 CTTTATCAGCAGAATAAAAAGGG + Intergenic
941855231 2:170224109-170224131 CTTGCTAAGCAGAGGCATAGTGG + Intronic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1172379938 20:34481524-34481546 CTTTATCAGCAGCAGGAAAGTGG - Intronic
1172582957 20:36063265-36063287 CATAGTCAGCAGAAGCAAAGAGG + Intergenic
1173386097 20:42589285-42589307 CTTTATCTGGAGAATCAAAGAGG + Intronic
1175585532 20:60136489-60136511 CTTTGTCAGGAGGACCATAGAGG + Intergenic
1175935202 20:62510839-62510861 GTTAATCAGCAGAAGGATGGAGG - Intergenic
1184349410 22:43933912-43933934 CTTTATAAGCAGATGAGTAGAGG + Intronic
954272831 3:49523051-49523073 CCTTAGCAGCAGAGGCACAGAGG - Intronic
955604758 3:60689288-60689310 CTTTATCAGCAGCAGTAAAAAGG + Intronic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
958744461 3:98115521-98115543 ATTTATCAGCAGAAACCTTGTGG - Intergenic
959947862 3:112146042-112146064 CTTTATCAGCAGCAGAAAAACGG + Intronic
960033242 3:113076911-113076933 CTTTATCACCAGAAACAAGGTGG + Intergenic
960675341 3:120188733-120188755 GATAATGAGCAGAAGCATAGAGG + Intronic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
969161358 4:5261838-5261860 TTTTATTAGCAGAAGCACTGAGG + Intronic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
969852304 4:9969570-9969592 CTTTATCAGCAGCATCAAAAGGG - Intronic
970710144 4:18852164-18852186 CTTCAGCAGCAGAAGTATACAGG + Intergenic
971309294 4:25511273-25511295 CATTTTCAGCATATGCATAGTGG - Intergenic
971742089 4:30534086-30534108 CTTTATCAGCAGCATGAAAGTGG + Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
973035068 4:45396325-45396347 CTTTATCAGCAGAATTAAAATGG - Intergenic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
978077413 4:104550215-104550237 ATTTATCTGCTGCAGCATAGAGG + Intergenic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
979464493 4:121021246-121021268 CTTTATCAGCAGCATGAAAGTGG - Intergenic
979955370 4:126947652-126947674 CTAGATCAGCAGAAGTATAGAGG - Intergenic
980137446 4:128872232-128872254 CATTATCAGGAGAAGCATCTTGG + Exonic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984652469 4:182285426-182285448 CAGTATCAGCAGACACATAGTGG - Intronic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG + Intronic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
988378137 5:30465469-30465491 ATTTATCAGCAGAAACTTTGTGG + Intergenic
989285249 5:39691863-39691885 CTGTAGCATCAGAAGCCTAGTGG - Intergenic
991604306 5:68384913-68384935 CTTAATCAGAAGAGGCATAAAGG + Intergenic
993030046 5:82695160-82695182 CTTGATCAGCAGATGCAAACAGG + Intergenic
995078311 5:108014737-108014759 CTTTATCAGCAGCATGAAAGCGG - Intronic
995280132 5:110325325-110325347 CTTTGACACCAGCAGCATAGTGG + Intronic
995749547 5:115439816-115439838 ATTTCTCAGCAGAAACATTGTGG - Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
998512916 5:142728635-142728657 CCTGATCAGCAAAAGCATACAGG - Intergenic
999201697 5:149821222-149821244 CTTTTTCAGCTGGAGCCTAGAGG + Intronic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1001795388 5:174498110-174498132 CTTTATCAGCAGCATAAAAGTGG + Intergenic
1003289392 6:4766586-4766608 CTTTATAAGCAAATGCATACAGG + Intronic
1003952283 6:11127464-11127486 CTTTATCAGCAGCATGAAAGTGG - Intronic
1008162048 6:48090478-48090500 ATTTTGCAGCAGAATCATAGAGG + Intergenic
1008568440 6:52792085-52792107 CTCCATCAGCACAAGCATGGAGG + Intronic
1008895236 6:56545691-56545713 TTTTATCAGCTGAAACATGGAGG + Intronic
1008930334 6:56932391-56932413 CTTTATCAGCAGAATGGAAGTGG + Intronic
1010254480 6:73742240-73742262 TTATATCAGCAGAATCATACAGG + Intronic
1010305519 6:74316936-74316958 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1011384573 6:86781287-86781309 CTGTGTTAACAGAAGCATAGCGG - Intergenic
1011876630 6:91970720-91970742 CTTTATCAGCAGAGTAAAAGTGG - Intergenic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1012026652 6:94002795-94002817 CTTCAACAGCAGAAGCACGGAGG - Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1013024426 6:106256189-106256211 CTTTCTCTCCAGAAGCATAAAGG - Intronic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013589929 6:111611379-111611401 CTTTATCAGCAGCATCAAAATGG - Intergenic
1014322098 6:119942758-119942780 CTTGTTCTGGAGAAGCATAGAGG - Intergenic
1014327706 6:120019254-120019276 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1015537573 6:134282064-134282086 TTATATCAGTAGAAGCATTGAGG + Intronic
1016437437 6:144051590-144051612 CTTTATCAGCAGCATGAAAGAGG - Intronic
1018031902 6:159848056-159848078 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1018131379 6:160735151-160735173 CTTTTTCTGCAGAAGCATCTTGG + Intronic
1018485936 6:164241220-164241242 CTTTATCAGCAGAATGAAAGTGG - Intergenic
1021170497 7:17393519-17393541 CTTTATCAGCAGCAGCAACATGG - Intergenic
1022165028 7:27750466-27750488 CTGTATAAGCAGAGGCTTAGAGG + Intronic
1022798451 7:33752105-33752127 GTTTAAAAGCATAAGCATAGAGG + Intergenic
1023016734 7:35975957-35975979 CTTTATTAGCAGAAAGACAGTGG - Intergenic
1024424859 7:49213511-49213533 CTTTATCAGCAGAGTGAAAGTGG - Intergenic
1025819423 7:64948063-64948085 CTTTTTGAGCTGAAGCATAGGGG - Intergenic
1027557328 7:79681904-79681926 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028795032 7:94893041-94893063 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1030195716 7:106851640-106851662 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1040400222 8:47043189-47043211 CATTGTCAGCAGAGGGATAGAGG - Intergenic
1043788597 8:84433764-84433786 CTTTATCAGCAGCATGATAATGG + Intronic
1043837008 8:85060073-85060095 CTTTAGCAGCAGAACCACATGGG - Intergenic
1043888174 8:85626548-85626570 CTTTCTCAGCATAGTCATAGGGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044477418 8:92644914-92644936 CTTTATCATCAGATTCATGGTGG + Intergenic
1044538073 8:93380665-93380687 CTTTATCAGCAGCATGATAATGG - Intergenic
1044760547 8:95513461-95513483 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1048770403 8:137888920-137888942 CTTTATCAGCAGCATGATAACGG + Intergenic
1050004838 9:1119186-1119208 CTTCATCAGCAGATGCCTACAGG + Intergenic
1050099259 9:2100808-2100830 CTTTATCAGCAGCATCAAACTGG - Intronic
1050318721 9:4429238-4429260 CTTTATCATCTTAAGAATAGCGG - Intergenic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051502334 9:17791586-17791608 CATTATCAGCAGTAGCATCCTGG - Intronic
1052490173 9:29156599-29156621 AGTTATCAGAAGAAACATAGTGG - Intergenic
1053080601 9:35173251-35173273 CTTTGTCTGCAAAAGGATAGAGG + Intronic
1055083279 9:72289339-72289361 CTTTATCAGCAGTATGAAAGTGG - Intergenic
1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG + Intronic
1062260269 9:135658830-135658852 TTTTATCTTCAGAAGCATACCGG - Intergenic
1185869019 X:3648284-3648306 CTTTATTAACAGACACATAGGGG + Intronic
1186649593 X:11544263-11544285 CATTAACAGCAGATGCCTAGTGG + Intronic
1186985185 X:15005177-15005199 CCTTCTCAGCAGAAGCTTATAGG + Intergenic
1189192390 X:39121867-39121889 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189371167 X:40430680-40430702 CTTTATCAGCAGCATCAAAACGG + Intergenic
1189464607 X:41268882-41268904 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1190236039 X:48616582-48616604 CTTTATCGGCTGAAGAGTAGTGG - Intergenic
1190384147 X:49868282-49868304 TGCTATCAGCAGAAGCATTGTGG - Intergenic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1193320282 X:80113973-80113995 CTTTATCAGCAGCAAGAAAGTGG + Intergenic
1193449341 X:81646401-81646423 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1194300746 X:92182832-92182854 CTTTATCAGCAGCATGAAAGTGG + Intronic
1195672583 X:107482283-107482305 CTTTGTCAGCAGAGGCTTACTGG + Intergenic
1195758198 X:108220064-108220086 CCTTATCTGTAGAAGCATAATGG - Intronic
1196542238 X:116923451-116923473 CTTTATCTGCAGGAGCATAATGG + Intergenic
1197155260 X:123263460-123263482 CTTTCTCAGCAGTAGAACAGAGG + Intronic
1199015233 X:142807170-142807192 CTTTATCAGCAGCATCAAAATGG - Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1201184717 Y:11389146-11389168 CTTTATCAGCAGAATGACAACGG + Intergenic