ID: 1100506387

View in Genome Browser
Species Human (GRCh38)
Location 12:95224827-95224849
Sequence CAGTTTTTCCAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100506384_1100506387 0 Left 1100506384 12:95224804-95224826 CCAGGGACTTGTTTCGTGGAAGA 0: 1
1: 141
2: 979
3: 1702
4: 1513
Right 1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG 0: 1
1: 0
2: 2
3: 38
4: 379
1100506379_1100506387 28 Left 1100506379 12:95224776-95224798 CCTAATGCACAGTGACTGGTTTT 0: 1
1: 0
2: 1
3: 25
4: 223
Right 1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG 0: 1
1: 0
2: 2
3: 38
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100506387 Original CRISPR CAGTTTTTCCAGATGGAGGA TGG Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
901772738 1:11538913-11538935 CAGGTTTTCCAGATGTTGGATGG - Intergenic
902665828 1:17937302-17937324 AAGGTTTTCCAGATGGACAAGGG - Intergenic
903010160 1:20324169-20324191 CTGTTTTTCCAGATGGCCAAGGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905365642 1:37449807-37449829 CAGTTTGTCCCCAGGGAGGAAGG - Intergenic
905676439 1:39828854-39828876 CAGTTTTGCCATATGGAAAATGG + Intergenic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
907236134 1:53049732-53049754 TAGTTTGTCCAGACAGAGGAAGG + Intronic
907380038 1:54079565-54079587 CAAGTTTTGAAGATGGAGGAAGG - Intronic
907678706 1:56543098-56543120 CAGTTTTTCCATTTGTAAGATGG - Intronic
908326401 1:63028097-63028119 CAGTTTCTCCACATGGTGGGAGG - Intergenic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
911271698 1:95809506-95809528 TGGTTTTTCCACAGGGAGGAAGG + Intergenic
911521841 1:98939276-98939298 TAATTTTTCCATATAGAGGAAGG + Intronic
915099889 1:153491489-153491511 GAGTTTTTCCTCATAGAGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918477521 1:184941096-184941118 CAGTTTTGACAAATGGAAGAAGG + Intronic
918668044 1:187177272-187177294 CACCTTTTCCACATGGAGGCAGG + Intergenic
921355868 1:214283649-214283671 CAGTCTGTCCAGATGTATGAGGG + Intronic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924567994 1:245213808-245213830 CAGAATTTCCTGATTGAGGATGG + Intronic
1063017388 10:2092653-2092675 CCGATTTTCCAGATGCAGGCAGG - Intergenic
1063292350 10:4762201-4762223 AAGTTTTCCCAGATGGAGGCAGG - Intergenic
1063721735 10:8589368-8589390 CAGTTTCTCCATTTGGAAGAAGG + Intergenic
1064040551 10:11959251-11959273 CGGTTTTTTCAGCTGGAGGTGGG + Exonic
1065513273 10:26500763-26500785 CAGTTTTTCCAGATGCAAATAGG + Intronic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1067897206 10:50196373-50196395 CAGTTTTTCTGGGGGGAGGAGGG - Intronic
1067951766 10:50745652-50745674 CAGTTTTTCTGGGGGGAGGAGGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070192406 10:74124010-74124032 CATTTCTTCCAAATGGTGGAAGG - Intronic
1070568945 10:77626393-77626415 AAGTGTTCCCAGATGCAGGAAGG + Intronic
1070700037 10:78595264-78595286 CAGTTTTGACTGATGGAGGGTGG + Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071937560 10:90548300-90548322 CAATTTTTCTAGGTAGAGGAAGG - Intergenic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1072107810 10:92290987-92291009 CATTTTTTCCCCCTGGAGGAAGG + Intronic
1075047377 10:119156725-119156747 CAGTTTGTCCAGATGAAGTATGG - Exonic
1075130318 10:119732379-119732401 CAGGTTTTACAGATTGAGGGAGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1080163198 11:29204193-29204215 CATTTTTTTCAGATGCAGGTAGG - Intergenic
1080849756 11:36057945-36057967 CAGTTTTCTCATCTGGAGGAGGG + Intronic
1081457227 11:43235865-43235887 GTGATTTTCCAGTTGGAGGATGG + Intergenic
1081982994 11:47281606-47281628 AAATTTCTCCAGATTGAGGATGG - Exonic
1082311813 11:50659133-50659155 CAGATTTTCCAAATGGCTGAAGG - Intergenic
1083222504 11:61262276-61262298 CAGTTTCCCCAGGTGGAGGTAGG + Intronic
1083641509 11:64148218-64148240 CAGCTTTTCAGGATGGAGGAGGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1085237357 11:75025428-75025450 CAGTTTTCCCAGCTGTACGATGG + Intergenic
1085417177 11:76327015-76327037 AAATTTTTTGAGATGGAGGATGG - Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1087171527 11:95054174-95054196 CAGCTTTTCCAGAAGTAGGGTGG - Intergenic
1089281395 11:117377179-117377201 CAGTTTTTCCAGATGGGGCCAGG + Intronic
1090216876 11:124975166-124975188 CAGTGTTTCCAGATGATGGAAGG + Exonic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093011204 12:14109225-14109247 CAGTTTTTTCAGGAGGGGGATGG + Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1096511732 12:52133743-52133765 CATTTTTTCAAGATTAAGGATGG - Intergenic
1096608811 12:52787712-52787734 GAGTTTTTCCAGAGAGAGGGTGG - Intergenic
1096691355 12:53324074-53324096 CAGTTTTTCCAGGGGGAGCGGGG + Intronic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1097764970 12:63515322-63515344 CAGTTCTTCCATTTTGAGGAGGG + Intergenic
1097937115 12:65265192-65265214 CAACATTTCAAGATGGAGGAAGG + Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1100042011 12:90331372-90331394 CAGTGTTTGTATATGGAGGAGGG + Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100194321 12:92227077-92227099 CAGTTTTTACTCATGGTGGAAGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101204740 12:102475448-102475470 CAGGTTTTGCAGATCTAGGATGG - Intronic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1101566181 12:105907772-105907794 CAGTTTTCCCATCTGGAAGAAGG - Intergenic
1101853352 12:108422165-108422187 TACTTTCTCCAGATGGAGGCAGG - Intergenic
1101861244 12:108484088-108484110 CACTTTTCCCATATGGAGAAAGG - Intergenic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1103163365 12:118749629-118749651 CAGTTCTTCCAGGTGGAGGTTGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1105553894 13:21427424-21427446 CAGATTTTCTACTTGGAGGAGGG - Intronic
1106273815 13:28183442-28183464 CCGCTTGTCAAGATGGAGGAGGG + Intronic
1106345459 13:28872554-28872576 CAGCTTCTCCACATGGTGGAAGG + Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106717752 13:32408638-32408660 CAGTTTTTACAGATGCGGAAAGG - Intronic
1106998341 13:35514480-35514502 CAGTTTTTTCTGATTGAGGGTGG - Intronic
1110068026 13:71133533-71133555 CTGGTTTTCAAGATGGAGGTAGG + Intergenic
1110731013 13:78878183-78878205 CAGGTCTTGAAGATGGAGGAAGG - Intergenic
1113443792 13:110350171-110350193 CATTTTTTCCAGGTGCAGAACGG - Intronic
1113758808 13:112833357-112833379 CAGTTTTCTGAGATGCAGGAGGG - Intronic
1113765566 13:112878757-112878779 CAGTCTTTCCAGCTGCAGAATGG - Intronic
1116420290 14:44724246-44724268 CATTCTTTCCAGATGGAAAATGG - Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1119439819 14:74620568-74620590 CAAACTTTCCAGATGGAGGGAGG - Intergenic
1119651788 14:76389099-76389121 AAAGTTTTCCAGATGTAGGAGGG - Intronic
1119746077 14:77045047-77045069 AAGACTTTCCAGATGGGGGAAGG + Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121866472 14:97367005-97367027 TATTTTTTTCTGATGGAGGAAGG + Intergenic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122528654 14:102408654-102408676 TAGTTTTTCCAAATGTAAGAAGG - Intronic
1123907572 15:24935762-24935784 CACTTTTTCCAGAAGCAAGAAGG - Intronic
1125787604 15:42335022-42335044 CAGTTTTACCAGATGTACAAAGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126782721 15:52152239-52152261 CAGTTTTTCCAAAAGCAGGTTGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127342335 15:58060616-58060638 CTCTTTTTCCAAATGAAGGAAGG + Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128788698 15:70416793-70416815 CAGTTTTTCCAACTGGAAAACGG + Intergenic
1129865869 15:78908141-78908163 TATTTCTTCCAGATGGAGGAAGG + Intergenic
1131548491 15:93335785-93335807 CAGTTTTCCCAAATTGATGAGGG + Intergenic
1131768320 15:95705476-95705498 AACTTATTCCAGCTGGAGGAAGG - Intergenic
1131877395 15:96825057-96825079 CAGTCTTTCCTAATGGATGAAGG + Intergenic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133490261 16:6261325-6261347 CAGTTTTTCCATCTTGAGGAAGG + Intronic
1134534775 16:15017244-15017266 CAGTTTTTATGAATGGAGGAGGG + Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135386138 16:22042059-22042081 GAGATTTTTCAGGTGGAGGAGGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135791186 16:25397722-25397744 TAAGTTTTCCAGATGTAGGAGGG + Intergenic
1135918026 16:26623638-26623660 CAGTTTTCCCATCTGGAGAATGG - Intergenic
1137315799 16:47321107-47321129 TAGATTTTCCAGATGGTGGAAGG - Intronic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1138137672 16:54537487-54537509 CAGTTTTTCCTGGGAGAGGAAGG + Intergenic
1139347128 16:66311085-66311107 TAGTTTTTCCATATTCAGGAGGG - Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139861265 16:70023532-70023554 CAGTTTTTATGAATGGAGGAGGG - Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141911997 16:87066637-87066659 CATCTTCTCCAGTTGGAGGAAGG + Intergenic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1143895971 17:10136440-10136462 CAGATTTTCCAGACTGGGGAAGG + Intronic
1144046658 17:11460217-11460239 GATTTTGTCCAGATGCAGGAAGG + Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1147692760 17:42327206-42327228 CAGTTATTTCTGAGGGAGGAGGG - Intronic
1147896020 17:43751899-43751921 GAGATTTTCCAGGTGGAGAAGGG - Intergenic
1148125192 17:45233113-45233135 CACTTGTGCCAGTTGGAGGAGGG + Intronic
1148149462 17:45388094-45388116 CAGTTTTTTCACCTGGAGAATGG - Intergenic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1149041530 17:52195550-52195572 CACATGTTCAAGATGGAGGAAGG - Intergenic
1149811059 17:59672590-59672612 CAGATTTTCCACATTAAGGAAGG - Intronic
1149854398 17:60067492-60067514 CAGTTCTTCCAGTTGGAAAAGGG - Exonic
1150861442 17:68805025-68805047 CAGTTTTTCCATATCCAGTATGG - Intergenic
1150878213 17:68993709-68993731 CATCTTTTCTAGATGGTGGATGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1155791219 18:29973064-29973086 TAGATATTCCAGATGAAGGAAGG + Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1156708455 18:39912522-39912544 CAGCTTTTCTAGATAGGGGATGG - Intergenic
1157428375 18:47602911-47602933 CAAATTTTCCAGATGGAGTTGGG + Intergenic
1157699452 18:49751658-49751680 CAGTTTTCCCGGAGTGAGGATGG - Intergenic
1158246296 18:55436048-55436070 CAGTTTTTCTGGATGTAGGTAGG - Intronic
1158802083 18:60923897-60923919 CAGTTCTGCCAGATGGAGTAGGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160657898 19:282661-282683 CAGTTTTTCCAGCTGTAAAATGG - Intronic
1160935792 19:1593850-1593872 CAGTTTCTCCAGCTGGAGGCAGG - Intergenic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1163335826 19:16671026-16671048 CAGTTTGCCCATATGTAGGAGGG - Intronic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1167981398 19:53279362-53279384 CAATTTTTCCAGATGTTTGATGG + Intergenic
1168157677 19:54485374-54485396 CAGCTTGTCCAGGTGGTGGACGG + Intergenic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
925568040 2:5277863-5277885 GAATTTGTCCAGATGGAGGAAGG - Intergenic
925734372 2:6948491-6948513 CAGTTTTCTCAGCTGGATGATGG - Intronic
926381500 2:12295078-12295100 CACTTTTTACAGATGTAGGGAGG + Intergenic
926412219 2:12616284-12616306 CAATTTTGGCAGCTGGAGGAAGG + Intergenic
926670317 2:15571195-15571217 CAGTTTTTCCACATAGCTGAAGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929050208 2:37829992-37830014 CAGTTTTCTCAGTTTGAGGAGGG - Intergenic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
929262498 2:39881425-39881447 CAGGTTTTCCAGATTCAGTAAGG - Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
932079123 2:68695352-68695374 CAGGTTATCAAGATGGGGGAGGG - Intronic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
933121985 2:78549979-78550001 AAGTTTTTCAAGATGTACGATGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938979714 2:136514560-136514582 GGGTTTTTCCAGCTGGAGGGAGG + Intergenic
940164766 2:150758349-150758371 CAGTTTCTTCAGAAGGAGAAAGG + Intergenic
940323903 2:152404952-152404974 CAGTTTTTCAAACTGGAGGAAGG - Intronic
940514456 2:154663585-154663607 CAGTTTCTCCAGTTTGCGGATGG + Intergenic
941046377 2:160680261-160680283 CAGTATTTCCAGATGGTTCAAGG - Intergenic
941167476 2:162098139-162098161 CAGATTTTCCAGGTCTAGGAAGG - Intergenic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942135475 2:172920791-172920813 TAGTTCTTTCAGATGGATGATGG + Intronic
942325468 2:174772649-174772671 CAGCTGTTCTAGATGAAGGAAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943597316 2:189873903-189873925 GAGTTTTTCCAGTTGGCGGGTGG - Intronic
944142190 2:196468693-196468715 CAGATTTTCCACATGAATGAAGG + Intronic
946563567 2:220939829-220939851 CAGGTTTTTCAGCTTGAGGATGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1172117296 20:32580747-32580769 CAGTTTTCCCATCTGGAAGATGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173339019 20:42137392-42137414 CATCTTTTCCAGAAGGAGGTGGG - Intronic
1173561832 20:44011608-44011630 CAGTTTTACCAGATGGCTGAGGG + Intronic
1173650915 20:44663511-44663533 CAGTCTTCCAGGATGGAGGATGG + Intergenic
1173964355 20:47100548-47100570 CAGTTTCTCCTTATGGACGATGG - Intronic
1174546851 20:51332045-51332067 CAGTTTTTCCACTTGGAAAATGG - Intergenic
1175010954 20:55735519-55735541 CAGGTCTTAAAGATGGAGGAAGG - Intergenic
1175905965 20:62379621-62379643 CAGTTTTCCCATTTGGAGGCAGG - Intergenic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176214005 20:63939675-63939697 CACTTGTGCCAGATGAAGGAAGG - Intergenic
1176997578 21:15574633-15574655 CAGATTTTGCAGATGGAAGTGGG - Intergenic
1177858239 21:26423375-26423397 CAGTTATTCCAGATTGATGTAGG - Intergenic
1178585413 21:33867043-33867065 CACACTTTCCAGATGGAGAATGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1182079832 22:27521139-27521161 CAGTTTTCCCAGCTGCAGAATGG - Intergenic
1182203564 22:28599360-28599382 CATTTCTTTCAGATGGGGGAGGG - Intronic
1183214303 22:36469163-36469185 CAGTGTTCTCAGATGCAGGATGG + Intronic
1183320656 22:37163351-37163373 CACCCTTTCCAGCTGGAGGATGG - Intronic
1183830620 22:40416778-40416800 CAGTGCTTCCAGCTGAAGGACGG + Intronic
1184323464 22:43762345-43762367 CAGTTTTGCCATTTGGAGTATGG - Intronic
949149600 3:750116-750138 CAGTTTTTCCATTTGGGGGATGG - Intergenic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952733154 3:36661097-36661119 TCCCTTTTCCAGATGGAGGAGGG + Intergenic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
954463127 3:50638913-50638935 CTGTGTTTCCTAATGGAGGAGGG - Intronic
954756147 3:52841186-52841208 GAGTTTGTCCTGATGGAGGTCGG - Intronic
955397369 3:58566684-58566706 TGGTTTTTCCAGCTGAAGGAGGG + Exonic
956091134 3:65668156-65668178 CAGTTTTTCCATCTGCAAGATGG + Intronic
956887266 3:73572808-73572830 TAGTTTTCCCAAATGCAGGAGGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
959912548 3:111779842-111779864 AAGTATTTCCATATAGAGGATGG - Intronic
960304024 3:116039525-116039547 CAGCTTTTCAAGATGGTGCATGG - Intronic
961370992 3:126431399-126431421 CAGTTTCTCCTGTTGGGGGAAGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
965502700 3:169475379-169475401 CAGTTTTTCCAGAAGCAAAATGG - Intronic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965632600 3:170748423-170748445 CGTTGTTTCCAGATGGAGGTAGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
967652996 3:192009380-192009402 CAGTGATTCCTGATTGAGGAGGG + Intergenic
969082629 4:4631292-4631314 CAGTTTTGCAAGATGGATGGTGG - Intergenic
969117285 4:4878585-4878607 CAGTTTTTTCATCTGGATGATGG + Intergenic
969308263 4:6337704-6337726 CGGTTTTTCCTGCTGGAGGCTGG - Intronic
970482861 4:16495422-16495444 CAATTTTTTCTTATGGAGGATGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970936546 4:21577769-21577791 CAGAATTTCCAAATAGAGGAAGG - Intronic
971509752 4:27409341-27409363 AAGCTTCTCCAGTTGGAGGATGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972111709 4:35569838-35569860 CAGTTTTTTCAAAAAGAGGAAGG - Intergenic
972410150 4:38785629-38785651 CAGTTTTTCCATCTGGCGAATGG - Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
977243600 4:94603485-94603507 CAGTTTTCCCAGTTTGCGGAGGG - Intronic
977557949 4:98503708-98503730 GAGTTTATCCAGTTGTAGGAAGG - Intronic
977658207 4:99549209-99549231 CAGTCTGTCAGGATGGAGGAAGG - Exonic
977898300 4:102389149-102389171 CAGTCTTTCCTGTTGGAGGGGGG - Intronic
978804848 4:112789043-112789065 GATTTTTTTAAGATGGAGGAAGG - Intergenic
980263565 4:130485903-130485925 CAGTTTTTCCAGTTGGGAAATGG + Intergenic
981088594 4:140709390-140709412 CAGTTTTGCCAACTGGGGGACGG + Intronic
981260829 4:142716725-142716747 AAGTTTTTTCATATGTAGGATGG + Intronic
982157695 4:152537441-152537463 AAGTCTTTCCACCTGGAGGAGGG + Intergenic
988551723 5:32206243-32206265 CAGTTTCTCCATCTGGAGAATGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
992828625 5:80572737-80572759 CAGATATTGAAGATGGAGGAAGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993462360 5:88199420-88199442 CAGTTTTTATCCATGGAGGAGGG - Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
996962239 5:129264837-129264859 CAGTTTTTCCATAGCCAGGATGG - Intergenic
997025853 5:130060054-130060076 CAGGTTTTCCAGAAGGAGTTAGG - Intronic
997492417 5:134288786-134288808 CAGTTTTCCCAGCTGGATAATGG - Intronic
998588239 5:143450607-143450629 CACTTTTTCCATATGAAAGAAGG - Intergenic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
1000512582 5:162202055-162202077 CATTTTTTCTTGATGGAGAATGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001871435 5:175159602-175159624 CAGTTGCTCCAGATGCATGATGG + Intergenic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1004476647 6:15979511-15979533 CAATTTTTCCATATGGGGGGTGG - Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009160230 6:60273328-60273350 CAGTTTTGCCAGATCTAGGCAGG + Intergenic
1009163610 6:60312694-60312716 GAGCTTTTACCGATGGAGGAAGG - Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009435815 6:63617182-63617204 AAGTTTGTCCAGATGGAAGCAGG - Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1012326788 6:97929377-97929399 CAGGTTTTCCCCATGGGGGAAGG + Intergenic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1020606527 7:10344987-10345009 CTGTTTTGCCTGATGGTGGAAGG - Intergenic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021553053 7:21892381-21892403 CAGTTATTCCAAATGTAGGTAGG - Intronic
1022579401 7:31534160-31534182 CAGTTTTTCCACTGGAAGGAGGG - Intronic
1023821022 7:43980552-43980574 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1024843372 7:53613928-53613950 CAACTTTTCCAGAAGGAGGCTGG - Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1026241571 7:68579957-68579979 AAGTTCATCCACATGGAGGAGGG + Intergenic
1026327998 7:69327589-69327611 CAGCTGTTCCAGCTGGAGGATGG + Intergenic
1026984783 7:74547893-74547915 CAGTTTCCCCAGATGCAGAATGG + Intronic
1027328276 7:77065022-77065044 CAATTTTGCCAGCTGGAGAAGGG + Intergenic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1027875553 7:83763434-83763456 GAGTTTTCCCAGGTGGATGAAGG + Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029168015 7:98609290-98609312 CATATTTTCCTGATGGAGGCTGG + Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1029749295 7:102533991-102534013 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1029767238 7:102633095-102633117 CAATTTTGCCAGCTGGAGAAGGG - Intronic
1030156861 7:106464435-106464457 CACTTCTTTCAGAGGGAGGATGG + Intergenic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033180157 7:139169313-139169335 CAGTTCTTCCAGTTGGTGGGAGG + Exonic
1034486410 7:151366980-151367002 CACTATATCCAGCTGGAGGACGG - Exonic
1034727232 7:153348355-153348377 CAGTTGTTTCATATGGGGGAAGG - Intergenic
1034791645 7:153975887-153975909 CAGTCTTTCCATGTGTAGGATGG + Intronic
1037392337 8:18406581-18406603 GAGTTCTTTAAGATGGAGGAAGG + Intergenic
1037990483 8:23318525-23318547 CATTTTTTTCATCTGGAGGATGG - Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040567751 8:48582487-48582509 CAGTGTTTCCAGATGGCCGCTGG - Intergenic
1041053974 8:53963697-53963719 TTGTTTATCCAGCTGGAGGATGG - Intergenic
1041108434 8:54463674-54463696 CAGTGTTTGTATATGGAGGATGG - Intergenic
1041305124 8:56449615-56449637 CATTATTTTCAGATGGAAGATGG + Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043413725 8:80027978-80028000 CAGTTTTTCCAGGAGGAGGCTGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046730690 8:117722800-117722822 CAGTTGTTTAAGTTGGAGGAAGG - Intergenic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1047983147 8:130204288-130204310 CAGTTTTTCCACATACAAGAGGG - Intronic
1048023712 8:130564706-130564728 CAGCTTTTCCGGAGGGAGGGAGG - Intergenic
1048328566 8:133456821-133456843 CACTTTTTCCAGATGCTGAATGG + Exonic
1048353268 8:133633022-133633044 CAGCTATTCCAGTTGGAGGATGG + Intergenic
1049016467 8:139923542-139923564 GAATTTTTCCAGGTGGAGGTGGG - Intronic
1050802692 9:9635876-9635898 TAATTTTTCCAGGTGAAGGATGG - Intronic
1050840684 9:10144959-10144981 CAGTTTTTCCAGAGGTGGGCCGG - Intronic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1051975385 9:22942036-22942058 CAGCTTTTCCAGGTGCACGATGG + Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052320632 9:27163715-27163737 CAGTTTATCCATATGGGAGATGG - Intronic
1053601769 9:39618175-39618197 AAGTTTGTCCAGATGGATGCTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053859421 9:42371946-42371968 AAGTTTGTCCAGATGGATGCTGG - Intergenic
1054251766 9:62724271-62724293 AAGTTTGTCCAGATGGATGCTGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054565878 9:66758770-66758792 AAGTTTGTCCAGATGGATGCTGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055102726 9:72481640-72481662 CAGTTTCTCCAAATGTAGAATGG - Intergenic
1055609648 9:78008479-78008501 CAGTTTTTCCAGTTGGATGGTGG - Intronic
1055922220 9:81472893-81472915 AAGTTTAGCCAGATGGAGGCGGG - Intergenic
1057255670 9:93545173-93545195 CAGTTCTTCCAAGTGGGGGATGG + Intronic
1057648104 9:96895895-96895917 CTGTTTTTCTAGATAGAGGCAGG - Intergenic
1058836183 9:108860266-108860288 GAGTCTTCCAAGATGGAGGAAGG + Intergenic
1058868215 9:109180683-109180705 CAGTCTTACGAGATGGATGATGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059454741 9:114392759-114392781 CAGTTTTCCCAAGTGGAGGGAGG + Intronic
1060425762 9:123504192-123504214 CAGTTTCACCAGATGGCGAAGGG - Intronic
1061257204 9:129459957-129459979 CAGTTTTTCCATCTGGGGAATGG + Intergenic
1061432755 9:130541721-130541743 CAGTTTCTCCAGCTGTAAGATGG + Intergenic
1061763094 9:132863898-132863920 AATTATTTCCAGCTGGAGGACGG + Intronic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1193086757 X:77453942-77453964 CAGTTTTTCCATATGTAAAACGG - Intronic
1193866941 X:86744618-86744640 CAGTTTTACCAGATACAGTAAGG - Intronic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1198054936 X:132984681-132984703 CAGTTATTCCAGTTGGGGGTTGG - Intergenic
1198301498 X:135338117-135338139 CAGTTATTCCAGTTGGGGGTTGG + Intronic
1199502532 X:148523820-148523842 CAGTTCCTCCAGATTGAGAAAGG + Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199941554 X:152632699-152632721 CAGCCTTTCCAGATGGAGAAAGG + Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic